ID: 1150969802

View in Genome Browser
Species Human (GRCh38)
Location 17:70015046-70015068
Sequence GTATGAGCTCCCTAGTTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150969800_1150969802 2 Left 1150969800 17:70015021-70015043 CCGTTCTCACAATAATCATTTAG No data
Right 1150969802 17:70015046-70015068 GTATGAGCTCCCTAGTTAGCTGG No data
1150969799_1150969802 8 Left 1150969799 17:70015015-70015037 CCTGCTCCGTTCTCACAATAATC No data
Right 1150969802 17:70015046-70015068 GTATGAGCTCCCTAGTTAGCTGG No data
1150969798_1150969802 17 Left 1150969798 17:70015006-70015028 CCTGTCTTTCCTGCTCCGTTCTC No data
Right 1150969802 17:70015046-70015068 GTATGAGCTCCCTAGTTAGCTGG No data
1150969797_1150969802 30 Left 1150969797 17:70014993-70015015 CCTGGATCTACTGCCTGTCTTTC No data
Right 1150969802 17:70015046-70015068 GTATGAGCTCCCTAGTTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150969802 Original CRISPR GTATGAGCTCCCTAGTTAGC TGG Intergenic
No off target data available for this crispr