ID: 1150970088

View in Genome Browser
Species Human (GRCh38)
Location 17:70018057-70018079
Sequence ATCCAAATCCACCACTCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150970085_1150970088 10 Left 1150970085 17:70018024-70018046 CCAAGACTGAGAGAGTCTGAGAA No data
Right 1150970088 17:70018057-70018079 ATCCAAATCCACCACTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150970088 Original CRISPR ATCCAAATCCACCACTCAAG GGG Intergenic
No off target data available for this crispr