ID: 1150976343

View in Genome Browser
Species Human (GRCh38)
Location 17:70091401-70091423
Sequence CTGTGTTGGAGGAGGGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 308}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150976343_1150976353 15 Left 1150976343 17:70091401-70091423 CCAGCTACCCTCCTCCAACACAG 0: 1
1: 0
2: 2
3: 29
4: 308
Right 1150976353 17:70091439-70091461 TGGAATAGTACGCATTTACAGGG 0: 1
1: 0
2: 0
3: 5
4: 66
1150976343_1150976354 16 Left 1150976343 17:70091401-70091423 CCAGCTACCCTCCTCCAACACAG 0: 1
1: 0
2: 2
3: 29
4: 308
Right 1150976354 17:70091440-70091462 GGAATAGTACGCATTTACAGGGG 0: 1
1: 0
2: 0
3: 6
4: 60
1150976343_1150976352 14 Left 1150976343 17:70091401-70091423 CCAGCTACCCTCCTCCAACACAG 0: 1
1: 0
2: 2
3: 29
4: 308
Right 1150976352 17:70091438-70091460 ATGGAATAGTACGCATTTACAGG 0: 1
1: 0
2: 0
3: 0
4: 62
1150976343_1150976350 -5 Left 1150976343 17:70091401-70091423 CCAGCTACCCTCCTCCAACACAG 0: 1
1: 0
2: 2
3: 29
4: 308
Right 1150976350 17:70091419-70091441 CACAGTGCAGGAGAGGCCTATGG 0: 1
1: 0
2: 1
3: 53
4: 680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150976343 Original CRISPR CTGTGTTGGAGGAGGGTAGC TGG (reversed) Intronic
900555775 1:3279666-3279688 CTGTGCTGCAGGAGGGCAGAGGG + Intronic
901044076 1:6385248-6385270 CTTTGTTGGAGGAGGTGACCTGG - Intronic
901489668 1:9590128-9590150 ATGTGACTGAGGAGGGTAGCTGG + Intronic
901776941 1:11566595-11566617 CTGTGCTGGCGGAGGGAGGCTGG - Intergenic
904886659 1:33743358-33743380 TTGTGATGGAGGAGGGAAGCTGG + Exonic
905876653 1:41435884-41435906 CTGTGTGGGCTGAGGGTGGCAGG - Intergenic
906109914 1:43315754-43315776 CTGTGGTGGGGGAGGGTAATGGG + Intronic
906953937 1:50357232-50357254 CTGTGTTGGTGACGTGTAGCTGG - Intergenic
907279959 1:53340889-53340911 CTGTTTTGGAGGAGAGCAGGTGG - Intergenic
907459117 1:54594707-54594729 CTGTGCATGGGGAGGGTAGCTGG + Intronic
907512957 1:54975911-54975933 CTGGGTTGGAGGGGGCTAGGGGG + Intergenic
908496161 1:64696977-64696999 CTGTGCTGGAGGAGATGAGCAGG + Intergenic
911935095 1:103960228-103960250 CTGTGCTGGTGGAGGGTGGGAGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
915025532 1:152826157-152826179 CTTTGTTGGGGAGGGGTAGCTGG + Intergenic
915103385 1:153516351-153516373 CTGGGGTGGAGTAGGGTAGCAGG - Intergenic
915458699 1:156056585-156056607 GTGAGATGGAGGAGGGTAGTAGG + Intronic
916444957 1:164863724-164863746 TTGTGCTGGAGGAGGGAATCTGG + Intronic
917662430 1:177190486-177190508 CTGTTTTGGAGAAGGGAAGAAGG - Intronic
918205046 1:182300708-182300730 GTGTGTTGGTGGAGGGTGGGTGG + Intergenic
918261041 1:182796614-182796636 ATGTCCTGGAGTAGGGTAGCTGG + Intronic
918877665 1:190070371-190070393 ATTTGATGGGGGAGGGTAGCAGG - Intergenic
921033431 1:211353884-211353906 CTGTGTTGAGGGAGGATACCAGG + Intronic
921180971 1:212630872-212630894 ATGTGCTGGAGGAGAGTAGGGGG + Intergenic
923162203 1:231324177-231324199 CTGTGGTGGTGGGGGGAAGCGGG + Intergenic
923290243 1:232538338-232538360 CTGTGTTGGAGAAGAGAAGTGGG - Intronic
924112282 1:240711941-240711963 CTGATTTGGAGGAGGGCAGTGGG - Intergenic
1062961322 10:1575672-1575694 CTGGGGTGGAGGAGGGTGGGAGG + Intronic
1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG + Intronic
1063950373 10:11216650-11216672 CTTTGGTGGAGGAGGTTGGCTGG + Intronic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1068716826 10:60198173-60198195 CTGTGGTGGGAGAGGGTAACTGG - Intronic
1069075779 10:64037132-64037154 CAGAGCTGGAGGAGGATAGCAGG - Intergenic
1069334440 10:67331151-67331173 CTGTGTTGGAGTAGTGTTGCTGG + Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1073470510 10:103719233-103719255 CTGGGGTGGAGGTGGGGAGCGGG + Intronic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1076490429 10:130857798-130857820 CTGAGCTGGAGGAGGGTTGTGGG + Intergenic
1076768086 10:132647695-132647717 CTGCCTTGGAGGAGGGTGGGTGG + Intronic
1077053485 11:578341-578363 CTGTGGTGGAGGAGTGTAAGAGG + Intronic
1081458195 11:43246254-43246276 CTGTATTGGAGGACAGAAGCAGG - Intergenic
1081508837 11:43747390-43747412 CTTTGATGGAAGAGGGTAGGAGG + Intronic
1082733061 11:56824204-56824226 CTGTGTTGGAGGAGATTTGCAGG - Intergenic
1083010392 11:59391849-59391871 ATCTGTTGGAAGATGGTAGCTGG - Intergenic
1083681064 11:64352107-64352129 CTAGGATGGAGGAGGGAAGCAGG - Intronic
1083715898 11:64576844-64576866 CTGGGTTGGGGGAGGCAAGCAGG - Intergenic
1084214414 11:67639772-67639794 CTGTGCGGGAGGAGGGCAGGTGG + Intergenic
1085020000 11:73200584-73200606 CTGAGTGGGAGCAGGGTGGCTGG + Intergenic
1085026431 11:73239276-73239298 GGGTGTGGGAGGAGGGAAGCAGG + Intergenic
1086009522 11:82083307-82083329 CTTTGTTGGTGTAGGGCAGCTGG + Intergenic
1086107082 11:83157745-83157767 CTGAGTTGGAGGGGGGTGGGGGG - Intronic
1087034757 11:93743964-93743986 GTGTGTTGGAGGTGGGGAGAGGG - Intronic
1089627306 11:119759589-119759611 CAGGGTTGGAGGAGGGTTGAGGG + Intergenic
1090071058 11:123545116-123545138 CTGCCCTGGAGGAGGGGAGCTGG - Intronic
1091761711 12:3091860-3091882 CTGTGTTGGAGGAGGGAGTATGG + Intronic
1091974225 12:4811570-4811592 ATGTGGTGTAGGAAGGTAGCTGG - Exonic
1095465259 12:42483143-42483165 TTCTGCTGGAGGAGGGTAACGGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097463694 12:59895868-59895890 TTTTGTTGGAGGAGGAAAGCAGG + Intergenic
1097465209 12:59914497-59914519 GTGTGATGGAGGAAGGTAGAAGG - Intergenic
1097920621 12:65068474-65068496 CTGTGTTGGAGGAGTGGAGAGGG + Intronic
1097949701 12:65414021-65414043 GGGAGGTGGAGGAGGGTAGCAGG + Intronic
1099741707 12:86645254-86645276 CTGGGATGGAAGAGGCTAGCAGG + Intronic
1100048497 12:90413780-90413802 CTGAGTTGGAGGAGGGTTGGTGG - Intergenic
1101227988 12:102708917-102708939 CTGAGTTGGGGCAGGGTAGGGGG + Intergenic
1101569137 12:105937039-105937061 CTGTTGTGGAGGAGGGGATCAGG - Intergenic
1102108030 12:110342557-110342579 CTGAGTTGGAAGAGGGGAGTGGG + Intronic
1103133886 12:118491157-118491179 CAGGGTTGGAGGAGGGTGGGTGG + Intergenic
1105577082 13:21663544-21663566 CTAAGGTGGAGGAGGGGAGCAGG - Intergenic
1105965305 13:25378162-25378184 CTGTGGTGGGGGAGGGTTACTGG + Intronic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1106310575 13:28550418-28550440 GTGTGTGGGGGGTGGGTAGCGGG + Intergenic
1108500465 13:51065619-51065641 CTGTGTTGGAGGATGGTTGTTGG + Intergenic
1110786540 13:79534878-79534900 GTGTGCTGGAAGAGGGTAGTAGG - Intronic
1110856167 13:80298921-80298943 TGGTATTGGGGGAGGGTAGCTGG + Intergenic
1111197012 13:84888188-84888210 ATGTGTTGGATGGGGGTGGCAGG + Intergenic
1111479794 13:88809894-88809916 CAGTGTTGGAGGTGGGTGGGAGG + Intergenic
1111756475 13:92402553-92402575 CTGTGTTGGGGGATGGTTTCAGG + Intronic
1112073010 13:95875710-95875732 CTGTGGTAGAGGTGGGTAGGAGG - Intronic
1112581343 13:100678872-100678894 GTGTGATGGAGGAGGATAGGAGG - Intergenic
1113692679 13:112322781-112322803 CTGTGCTGGGGGTGGGCAGCAGG + Intergenic
1113962958 13:114135424-114135446 CTGAGCTGGAGGTGGGTGGCAGG - Intergenic
1113973539 13:114209217-114209239 CTGTGTTGGATGCGGACAGCGGG - Intergenic
1114260757 14:21034485-21034507 CTGTGGTGGACCAGGGGAGCAGG - Intronic
1114527553 14:23376182-23376204 CTGTGCTGGGCCAGGGTAGCAGG - Exonic
1114772630 14:25445415-25445437 CTGTGTTGAAAGAGTGTAGTAGG + Intergenic
1116577388 14:46591778-46591800 CTGGGTTCAAGGAGAGTAGCTGG - Intergenic
1116991115 14:51277902-51277924 CTGCTTTGGAGGACGGTAGGGGG - Intergenic
1117714104 14:58563224-58563246 CTGTGTTTGAGGTGGGTGTCGGG - Intergenic
1119633682 14:76256722-76256744 CAGTGGTGGAGTAGGTTAGCTGG + Intergenic
1119866808 14:77981140-77981162 CTGGGCTGGGGGAGGGCAGCAGG - Intergenic
1120256677 14:82128900-82128922 CTGTGTTTGAGTAGAGTAGAAGG + Intergenic
1121081911 14:91115124-91115146 CAGTGCTGGAGGAGGGCAGCAGG + Intronic
1121629334 14:95411143-95411165 CTCTGTTGAAGGAGGATACCTGG - Intronic
1121757951 14:96418963-96418985 CCGTGTTGGAGCAGGGTTTCAGG - Intronic
1122143719 14:99676747-99676769 CTGTGATGCAGGTGGGAAGCGGG - Exonic
1122297150 14:100712086-100712108 CTGGGTTGTGGGAGGGGAGCAGG + Intergenic
1122309176 14:100783733-100783755 GTGTGGTTGAGGAGGGGAGCTGG + Intergenic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1122861985 14:104586826-104586848 GGGTGTTGGAGGAGGGAAGAGGG + Intronic
1124050213 15:26190095-26190117 CTGTGCTGGAGGTGGGGTGCTGG + Intergenic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1125787954 15:42339289-42339311 GTGTGTTGGAGGGGGGTGGTTGG - Intronic
1126574688 15:50185188-50185210 CTGGGTGGGAAGAGGGTATCTGG - Intronic
1128564558 15:68692051-68692073 CTGAGCTGCAGGAGGGGAGCTGG + Intronic
1128766718 15:70255595-70255617 CAGTGTTGGAGGTGGGGATCTGG - Intergenic
1128768245 15:70264147-70264169 CAGTGCTGGAAGCGGGTAGCAGG - Intergenic
1129233179 15:74208098-74208120 GTGAGGAGGAGGAGGGTAGCCGG + Intronic
1131433918 15:92408191-92408213 CTCTCTTGGAGGAGGGTTGTTGG - Intronic
1131764792 15:95663844-95663866 ATGTGTTGGAGGAGGGGGGAGGG + Intergenic
1133038229 16:3046418-3046440 CTGCGTCGGAGGAGGGTCTCTGG + Intergenic
1133335693 16:5005387-5005409 CTGGGTTGGGGGAGGGGAGATGG + Intronic
1133442323 16:5831174-5831196 CAGTGTTGGAGGTGGGAACCTGG + Intergenic
1136173373 16:28501946-28501968 CTGGGGTGGTGGAGGGTGGCCGG + Intronic
1136748084 16:32609779-32609801 GGGTGTGGGAGGAGGATAGCAGG - Intergenic
1137041800 16:35620058-35620080 CTGTGGTGGAGCAGGGTGGGGGG + Intergenic
1137559439 16:49493322-49493344 CTGTGTGGGAGGTGGGCTGCAGG - Intronic
1137932076 16:52598444-52598466 CTGTGGTTGATGGGGGTAGCAGG - Intergenic
1139663447 16:68438285-68438307 CTGGGCAGGAGAAGGGTAGCAGG - Intronic
1139876205 16:70148140-70148162 TTGTGTTAGTCGAGGGTAGCAGG - Intronic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1141599086 16:85114404-85114426 GTGTGTTGGAGGAGGGGAAAGGG - Intergenic
1203050221 16_KI270728v1_random:868986-869008 GGGTGTGGGAGGAGGATAGCAGG - Intergenic
1143028370 17:3953895-3953917 CTGAGTCGGGGGAGGGTAGAGGG - Intronic
1144274780 17:13655921-13655943 CAGTGTTGGAGGTGGGTGCCTGG + Intergenic
1144305160 17:13963263-13963285 CTCTGTTGGAGCAGGGGAGGGGG - Intergenic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146822719 17:35997724-35997746 AGGTGTTGGAGGTGGGTGGCTGG + Exonic
1146931145 17:36778805-36778827 CTGTGCTGGAGGAGGGCAGCTGG - Intergenic
1147282005 17:39369877-39369899 CACTTTTGGAGGAGGGTAGGAGG - Intronic
1148091148 17:45023180-45023202 CTTTGTGGGAGGTGGGTAGAGGG - Intergenic
1148130879 17:45262030-45262052 CTGTCCTGGAGGCGGGGAGCGGG + Exonic
1149575369 17:57708089-57708111 CTGTGGAGGAGGCGGGGAGCAGG - Intergenic
1150433788 17:65139076-65139098 CTGGGGTGGAGGAGGGGAGCTGG - Intronic
1150976343 17:70091401-70091423 CTGTGTTGGAGGAGGGTAGCTGG - Intronic
1152471905 17:80494190-80494212 CTGGAATGGAGGAGGGCAGCCGG - Intergenic
1152657818 17:81528089-81528111 CGGGGTTGGAGGAGGGGGGCAGG + Intergenic
1152802670 17:82339000-82339022 CTACGTTGGAGGAGGCTGGCCGG + Intergenic
1152811329 17:82384143-82384165 GGGTGTGGGTGGAGGGTAGCAGG - Intergenic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1153659635 18:7315548-7315570 CTGGCTTGGAGGAGGGCAACTGG - Intergenic
1153718914 18:7881429-7881451 CCGTCTTGGAGTAGGGCAGCGGG + Intronic
1154485036 18:14866460-14866482 CTGAGCTGTAGGAGGGTGGCTGG + Intergenic
1155381845 18:25231320-25231342 CTGTGTTGGAGGAGGACAGCTGG + Intronic
1155964094 18:32019596-32019618 CTGTGTTGGGAAAGGGTAGCAGG - Intronic
1156478658 18:37422403-37422425 GTGTGCTGGGGGAGGGGAGCTGG - Intronic
1159001002 18:62975079-62975101 GTGTGGTTGATGAGGGTAGCAGG + Intronic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1159321147 18:66850737-66850759 CTATGTTGGAGGGGGATGGCTGG + Intergenic
1159388652 18:67759550-67759572 CTGGGTTGGAGCAGGGAAGGGGG - Intergenic
1159613068 18:70547639-70547661 CTGTGGTGGTGGCTGGTAGCAGG + Intergenic
1160042793 18:75360802-75360824 CTGGGGTGGAGGAGGTGAGCAGG + Intergenic
1160773665 19:844689-844711 CTGGGTGGGAGGAGGCTAGGAGG - Intronic
1161520862 19:4722972-4722994 CTGTGTGGGAAGAAGGTAGGCGG + Intronic
1161585586 19:5103756-5103778 CTGTGTTGGAGAAGGATGGAGGG + Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1163236446 19:16033015-16033037 CAGTGTTGGATGTGGTTAGCGGG + Intergenic
1163476107 19:17527059-17527081 TCGTCTTGGAGGAGGGTGGCAGG - Intronic
1163519220 19:17781857-17781879 CTGTGTTGGGGGAGTCCAGCAGG + Intronic
1165468892 19:35991858-35991880 CTGTGTTGGAGGAAGCAAACTGG - Intergenic
1166647659 19:44544076-44544098 CTGAGTTGGTGGAGAGTAGATGG - Intergenic
1166975281 19:46601918-46601940 ATGGGGTGGTGGAGGGTAGCTGG + Intronic
1167022374 19:46887633-46887655 CTGAGTTGAAGGAGGGAAGTGGG - Intergenic
1167469048 19:49665327-49665349 CTGTCCTGGAGGAGGGAGGCGGG - Exonic
1168400203 19:56081171-56081193 CTGTGTGGGAGGCGGGTCCCAGG + Intergenic
1168717908 19:58539842-58539864 CTCTGTCTGAGGAGGGAAGCAGG - Intergenic
925907421 2:8547726-8547748 GGGTGTTGGAGGAGGGCACCAGG - Intergenic
928586911 2:32769109-32769131 CTGTGTTGGAAGAGAATAACAGG + Intronic
929897431 2:45974329-45974351 CTAGGTTGGAGCAGGGTAGGAGG + Intronic
930019654 2:46993872-46993894 CTGTGTTGGGGCAGGCAAGCAGG - Intronic
930702212 2:54469678-54469700 CTAGGTTAGAGGAGGGTAGGGGG + Intronic
937222810 2:120351843-120351865 CTGGGCTGGAGGTGGGCAGCTGG + Intergenic
937518505 2:122683177-122683199 CTGTGCTGGAGGTGAGTAGATGG + Intergenic
938461642 2:131501458-131501480 CTGGGCTGGAGGAGAGTGGCAGG - Intergenic
940974001 2:159923330-159923352 CTGTGTTTGAGGAGGCTAAATGG - Intergenic
941611994 2:167672986-167673008 GTGTGTGGGAGGGGGGTATCTGG + Intergenic
942563711 2:177246433-177246455 TTGCCTTGGAGGAGGGTAACTGG - Intronic
943560360 2:189454176-189454198 CTGTGTTGGAGAAGGGAGGCCGG + Intronic
944893574 2:204142157-204142179 CTGAGGTGGAGGAGGCCAGCAGG - Intergenic
945469511 2:210211466-210211488 CAGTGTTGGAGGAGGGGGCCTGG + Intronic
945894945 2:215471240-215471262 GTATGTTGGAAGAGGGAAGCGGG + Intergenic
946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG + Intronic
948028959 2:234800837-234800859 CTGTGGTGGAGGAGCTTGGCTGG + Intergenic
948554261 2:238796409-238796431 CTGTGTGGCAGGAGGACAGCTGG + Intergenic
1169425191 20:5491291-5491313 CTGTGTTCCAGGAGGATAACAGG + Intergenic
1169581312 20:7026355-7026377 GAGTGTTGGAGGAGGGGAGGTGG + Intergenic
1172484696 20:35291209-35291231 ATGTGGTGCAGGAGGGTAGGGGG + Intronic
1175222517 20:57425576-57425598 CTGTGTTGTAAGAGGGTGGGAGG - Intergenic
1175771427 20:61627061-61627083 GTGTTTTGGAGGAGGGTGGGTGG + Intronic
1175938139 20:62524568-62524590 CTGTGTTGGGGGAGGGTCCCAGG + Intergenic
1176092830 20:63326535-63326557 CAGTGCTGGAGGAGGGGTGCAGG + Intronic
1176196124 20:63836966-63836988 CTATGTTGGAGGTGGGGATCAGG - Intergenic
1176386503 21:6140760-6140782 CTGTCTTGGAGGAGGCGGGCCGG + Intergenic
1176723788 21:10413788-10413810 CTGAGTGGTAGGAGGGTGGCTGG + Intergenic
1176796292 21:13373015-13373037 CTGAGCTGTAGGAGGGTGGCTGG - Intergenic
1176960598 21:15154753-15154775 GTGTGTTGGGGGAGGGGAGGTGG + Intergenic
1178213944 21:30571961-30571983 CCATGGTGGAGGAGGGTGGCAGG + Intergenic
1178405869 21:32322846-32322868 CTGTGCTGTAGGACGGTAGCTGG - Intronic
1179255320 21:39710843-39710865 CTGTGTGGGAGGGAGGGAGCAGG + Intergenic
1179736970 21:43397492-43397514 CTGTCTTGGAGGAGGCGGGCCGG - Intergenic
1180002081 21:44999738-44999760 CTGTGTTGGTGGCAGGTGGCCGG + Intergenic
1180162748 21:46005653-46005675 CTGGGCTGGAGGAGGGCAGCAGG + Intergenic
1180755307 22:18156948-18156970 CTGGGTTGGGGGAGGGTACACGG + Intronic
1182186769 22:28412279-28412301 CTGTTCTGGAGAAGGGTAGCAGG - Intronic
1182712831 22:32333270-32333292 CTGTGCTGGAAGTGGGCAGCAGG + Intergenic
1183279034 22:36922434-36922456 ATGTGCAGGAGGAGGGAAGCGGG - Intronic
1184875211 22:47269997-47270019 CGGTGTTGGAGGTGGGTGGCAGG + Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185347743 22:50317785-50317807 CTGTGTGGCAGGAGAGGAGCTGG - Intronic
951119861 3:18913990-18914012 CTGTTTTGGAGGACAGTAGATGG - Intergenic
951177334 3:19617310-19617332 CAGGCTTGGGGGAGGGTAGCGGG - Intergenic
951277047 3:20700355-20700377 CTGTGTTGGAGAAGGTTATAGGG + Intergenic
952406759 3:33012232-33012254 CAGTATTGGAGGAGGGTTGTTGG - Intronic
953413920 3:42704719-42704741 CTGTGTCTGAGGGGGGTGGCAGG + Intronic
953419315 3:42742294-42742316 CTGCATTGGAGGAGAGAAGCTGG + Intronic
954055113 3:48016694-48016716 CTGTGTTAGAGGAAGGAAGTGGG - Intronic
954151153 3:48657764-48657786 CTATGCTGGAGGAGGGGAGAAGG - Intronic
955281240 3:57596959-57596981 CTGTGGTGGGGGAGGGGCGCCGG - Intronic
955391752 3:58527029-58527051 CTGGGTTGTAGGAGGGTGACAGG + Intronic
956436960 3:69243566-69243588 CTATGTCGTAGGAAGGTAGCTGG + Intronic
956826045 3:72997282-72997304 CTGGGCTGGGGGAGGGGAGCCGG + Intronic
959733782 3:109634013-109634035 CGATGTTGCAGGAGGGTAACTGG - Intergenic
961456913 3:127028931-127028953 CTGTGATGGAGGAGGGAAAGAGG + Intronic
961513768 3:127420300-127420322 CTGTCCTGGAGGAAGGTAGAGGG + Intergenic
962707659 3:138061172-138061194 TGGTGGTGGAGTAGGGTAGCTGG - Intergenic
962949188 3:140202471-140202493 CTGAGTTGGAGGAAGGATGCGGG + Intronic
964091830 3:152886310-152886332 CTGTGTTGGAGGAGAGAAGGTGG + Intergenic
965653272 3:170955742-170955764 GTCTGTTGGAGGAGGGTGGTGGG - Intergenic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
967192505 3:186997025-186997047 CTGTGTTGGAGGCGGGCAGGTGG + Intronic
967270248 3:187726897-187726919 CTCTGTTGGAGGGTGGTAGGGGG + Exonic
967844886 3:194035538-194035560 TTGTGTGGGAGGAGGGCAGTGGG - Intergenic
968110890 3:196045616-196045638 CAGTGTTGGAGGAGGGGGCCTGG - Intronic
968283161 3:197492246-197492268 CTGTGTTAGAGGAGGGGAGGAGG + Intergenic
968685411 4:1954735-1954757 GTGTGTGGGATGAGGGTGGCAGG + Intronic
968697823 4:2041460-2041482 CTGGGTTGGGGGTGGGTAGCCGG + Intronic
968727034 4:2252552-2252574 CTGGGGTGGGGGAGGGCAGCAGG + Intronic
969225977 4:5798593-5798615 GTGTGCTGGAGGAGGCCAGCCGG + Exonic
969716370 4:8870215-8870237 CTGTGTTGGGGGTGGGGGGCTGG + Intronic
971161448 4:24137867-24137889 CTGTGTTTGAGGGGGGAAACGGG - Intergenic
971173814 4:24261810-24261832 GTGTGTTGGAGGTGGGGAGGTGG - Intergenic
973890623 4:55364063-55364085 CTGAATTGTAGGAGGGGAGCTGG + Exonic
974489880 4:62551062-62551084 CTGAGATGGGAGAGGGTAGCTGG + Intergenic
974887484 4:67837665-67837687 CTGGGTGGTAGGAGGGTAGTAGG + Intronic
975495084 4:75028328-75028350 ATGTGCTGGAGGAGGGAAGTGGG - Intronic
977600238 4:98928278-98928300 CTGTCATGGAGGAGGGAAGGGGG - Intronic
977916520 4:102600416-102600438 GTATTTTGGAGGAGGGCAGCAGG + Intronic
980153964 4:129081669-129081691 CAGTGTTGGAGGAGGGGGCCTGG - Intronic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
982845506 4:160247113-160247135 CTGTGTTGGAGGACAGGAGTGGG + Intergenic
983063467 4:163183993-163184015 GTGTGTCTGAGGAGGGAAGCAGG - Intergenic
985936469 5:3101502-3101524 CTGGGTTGGGAGAGGGGAGCAGG - Intergenic
986610734 5:9564564-9564586 GTGAGTTGGAGGTGGGGAGCAGG - Intergenic
987029598 5:13963723-13963745 CTGTGGAGGAGGGGGGTAGTGGG - Intergenic
987441921 5:17967207-17967229 ATGGGTTGGAGCAGGGTGGCAGG - Intergenic
993164967 5:84341032-84341054 CTATGTTGGAGGAGGGATGAGGG - Intronic
993484208 5:88462520-88462542 ATGTGGTAGAGGAGGGAAGCAGG + Intergenic
997827794 5:137123188-137123210 CAGTGTTGGAGGAGAGGAGACGG + Intronic
998099043 5:139416765-139416787 CTGGGCTGGACGAAGGTAGCAGG - Intronic
998170439 5:139869522-139869544 CTGTGCTGGAGAAGGGCAGGGGG - Intronic
999208772 5:149869679-149869701 CTGTGCTGCAGGAAGGCAGCTGG + Intronic
999627579 5:153536519-153536541 CTGGGCTGGAGGAGGTTAGGAGG - Intronic
1001507125 5:172288481-172288503 GTGTGTTGGCGGCGGGTGGCGGG - Intergenic
1001778154 5:174344646-174344668 CTGTGTTGGAGGCAGGTAACAGG - Intergenic
1001989312 5:176103130-176103152 GGGTTTGGGAGGAGGGTAGCAGG - Intronic
1002227558 5:177735008-177735030 GGGTTTGGGAGGAGGGTAGCAGG + Intronic
1002323118 5:178387455-178387477 CTGAGCTGCAGGAGGGCAGCAGG - Intronic
1002355452 5:178625681-178625703 CTGTTTTGCTGGAGGTTAGCTGG - Intronic
1004465428 6:15880817-15880839 CCTTGAGGGAGGAGGGTAGCAGG - Intergenic
1005463529 6:26090791-26090813 ATGTGTAGTAGGAGGGGAGCAGG - Intronic
1006342183 6:33452858-33452880 CTGTGTTGGAGGAGGGGTGTTGG + Exonic
1006367090 6:33622019-33622041 CTGAGTTGGGGAAGGGCAGCCGG + Intronic
1010635872 6:78259039-78259061 CTGTGTTGGTTATGGGTAGCTGG - Intergenic
1011026704 6:82877474-82877496 CTCTCTTGGAGGAGGGTATGAGG + Intergenic
1011113519 6:83864862-83864884 ATGTATTGGAGGAGGTGAGCAGG + Intronic
1011625739 6:89282184-89282206 GTGTGGTGGAGGAGGGGGGCTGG - Intronic
1012947460 6:105482902-105482924 CTGCATTGGAGGAGGGGAGTGGG - Intergenic
1013166556 6:107598667-107598689 ATGGGTTGGAGGAGGGGAGCAGG + Intronic
1013702798 6:112794691-112794713 CTCTGTTTGAGCAGGGTTGCAGG + Intergenic
1014729806 6:125019747-125019769 CAGTGTTGGAGAAATGTAGCAGG - Intronic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1019631941 7:2054086-2054108 CTGTGTTGGGGGAGGTGGGCTGG - Intronic
1020035024 7:4959320-4959342 CTGAGGTGGAGGAGGGTCGTGGG + Intergenic
1021513481 7:21458780-21458802 GTGTGTGGGGGGAGGGGAGCGGG - Intronic
1021934416 7:25615657-25615679 ATGTCTTGGAGGATGTTAGCAGG + Intergenic
1022632402 7:32097706-32097728 CAGTGTTGGCTGAGGCTAGCTGG - Intronic
1024393909 7:48844719-48844741 CTGTGTTCCAGTAGGGTTGCGGG + Intergenic
1024401334 7:48927698-48927720 CTGTGTTCCAGTAGGGTTGCGGG - Intergenic
1025262713 7:57430478-57430500 CTGTTTTTGAGGAAGGTAGGTGG + Intergenic
1025740060 7:64187736-64187758 CTGTTTTTGAGGAGGGGAGGTGG + Intronic
1025801322 7:64789218-64789240 AGGTGTGGGAGGAGGGCAGCAGG - Intergenic
1026082033 7:67230483-67230505 TTGTGTTTGAGGAGGGTACAAGG - Intronic
1026438012 7:70416828-70416850 GTGTGTCAGAGGAGGGGAGCAGG - Intronic
1026695033 7:72583506-72583528 TTGTGTTTGAGGAGGGTACAAGG + Intronic
1027453285 7:78357774-78357796 CTGTGTTTGAGAAGGTTAACTGG - Intronic
1027684345 7:81264110-81264132 GTGGGTTGGTGGTGGGTAGCTGG + Intergenic
1027860676 7:83575219-83575241 CCCAGTTGAAGGAGGGTAGCAGG + Intronic
1029200712 7:98837384-98837406 CTGTGTGGGGAGAGGGTGGCTGG + Intergenic
1029529704 7:101117258-101117280 CTGTGTTGGAGGAAAGCAGGAGG + Intergenic
1031955016 7:127934166-127934188 CTGTGTTGGGGGAGGGGAGTAGG + Intronic
1032452787 7:132047766-132047788 CTGTCTTGAAGGAGGGTGGGGGG - Intergenic
1036648275 8:10625613-10625635 CTGTGTGGGAGGTGGGTTGGGGG - Intronic
1040600916 8:48883236-48883258 ATGTGGTGGAGGCGGGCAGCTGG - Intergenic
1043377678 8:79668733-79668755 CTCAGTAGGAGGAGGGTAGATGG - Intergenic
1045322412 8:101092031-101092053 CTTTGAGGGAGGAGGGTTGCGGG - Intergenic
1046197961 8:110887547-110887569 CAATGTTGGATGGGGGTAGCTGG + Intergenic
1046276742 8:111971348-111971370 CAGTGTTGGAGGAGGGGACCTGG - Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1049424509 8:142532136-142532158 CTGTGTAGGAGGAGGGGAGGAGG + Intronic
1049608142 8:143539190-143539212 CCGGCTTGGACGAGGGTAGCGGG + Exonic
1051331889 9:16032137-16032159 CTGTGAGGGAGGAAGGTGGCAGG + Intronic
1052492653 9:29188838-29188860 CTGTCTGGGAGGAAGGTGGCGGG - Intergenic
1056040366 9:82659443-82659465 GTGTGTTGGAGTAGGGTACAGGG + Intergenic
1057303439 9:93899474-93899496 CTCTGTATGAGGAGGGGAGCTGG - Intergenic
1057305586 9:93910342-93910364 CTGTGATGCAGGTGGGGAGCTGG + Intergenic
1057565616 9:96163948-96163970 CTGTGATGGGGCAGGGTGGCAGG - Intergenic
1058646832 9:107138838-107138860 CTGTGTTGGAGGATGGCCTCTGG + Intergenic
1060586938 9:124792540-124792562 CTGGCCTGGAGGAGGGTGGCAGG + Intronic
1061442238 9:130613429-130613451 CTTTGTGGGAAGAGGATAGCTGG + Intronic
1062521111 9:136958395-136958417 CTGCCTTGGGGGAGGGAAGCTGG - Intergenic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1062676576 9:137749097-137749119 CTGTCCTGGGGGTGGGTAGCAGG - Intronic
1062676590 9:137749148-137749170 CTGTCCTGGGGGTGGGTAGCAGG - Intronic
1186612313 X:11149457-11149479 GTGTGTTGGGGGAGGGGGGCAGG + Intronic
1187133999 X:16529433-16529455 CTGTGTGGGAGGTGGGGAGCTGG - Intergenic
1187362128 X:18638192-18638214 CTGTGTGGGAGGAGGTTACTTGG - Intronic
1187733681 X:22282447-22282469 CTGTGTTGGATGAGTGGGGCTGG - Intergenic
1187857809 X:23654099-23654121 CTGGGTTGGAGAAGGCTGGCAGG + Intergenic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1189740264 X:44110678-44110700 CTGTGTTTGAAGAGTGTAGAAGG - Intergenic
1190420664 X:50281301-50281323 CTGGGCTGGTGGAGGGTCGCAGG + Intronic
1190765472 X:53472650-53472672 CTGTGTTGGGTGGGGGAAGCAGG + Intergenic
1192556005 X:72089728-72089750 CTGGGATGGAGGAGTGTAGAAGG + Intergenic
1192656792 X:73002107-73002129 ATGTGTTGGAGGTGTGGAGCAGG - Intergenic
1192665328 X:73080894-73080916 ATGTGTTGGAGGTGTGGAGCAGG + Intergenic
1193096789 X:77557919-77557941 CTCTGTAGGAGGAGGACAGCAGG + Intronic
1193549403 X:82872033-82872055 GGGTGTTGGAGGATGGAAGCAGG + Intergenic
1197335698 X:125206643-125206665 TTGTTTTGTAGGAGGGTAGTGGG - Intergenic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1199599935 X:149535852-149535874 GTGGGTTGGAGGAGGGAAGGAGG - Intergenic