ID: 1150984261

View in Genome Browser
Species Human (GRCh38)
Location 17:70177545-70177567
Sequence TCCCTAAGGTGAAGGTGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150984261_1150984271 26 Left 1150984261 17:70177545-70177567 CCAGCCCACCTTCACCTTAGGGA 0: 1
1: 0
2: 2
3: 21
4: 195
Right 1150984271 17:70177594-70177616 GCTCTTCTGATCAGTCTGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 104
1150984261_1150984266 -8 Left 1150984261 17:70177545-70177567 CCAGCCCACCTTCACCTTAGGGA 0: 1
1: 0
2: 2
3: 21
4: 195
Right 1150984266 17:70177560-70177582 CTTAGGGAAGATGCCACACCTGG 0: 1
1: 0
2: 0
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150984261 Original CRISPR TCCCTAAGGTGAAGGTGGGC TGG (reversed) Exonic
900752779 1:4409279-4409301 TGCCTTAGGTGGGGGTGGGCAGG - Intergenic
900895516 1:5480365-5480387 TCCCTGGGGTGAAGGAAGGCAGG + Intergenic
901442268 1:9285628-9285650 ACCCCATGGTGAAGGTGGGCAGG + Intergenic
902242363 1:15097444-15097466 TCCATAAGGTGATGATGGGTTGG - Intronic
902740403 1:18433978-18434000 GCCATCAGGTGATGGTGGGCTGG - Intergenic
903502346 1:23808088-23808110 TCCCAAAGGTCACGGTGGGCAGG - Intronic
905014020 1:34764819-34764841 TCAAGAAGGTGAAGGTGGACAGG - Intronic
905687798 1:39921385-39921407 TACCAAAGTTGAAGTTGGGCCGG - Intergenic
908475016 1:64478822-64478844 TGCCAAGGGTGAAGGGGGGCAGG + Intronic
912496671 1:110096224-110096246 TACCTACGGTGGAGGTGGGAAGG + Intergenic
914941233 1:152024542-152024564 TTCCTGAGGTGCAGGGGGGCAGG + Intergenic
915437321 1:155917837-155917859 TCCCTAGGATGAAGGTGAGAAGG - Intronic
916763314 1:167836271-167836293 TCTCTAGGGTGGAGGTGGTCTGG + Intronic
917902800 1:179559886-179559908 ACCCTCAGGTGGAGGTGGGATGG - Intronic
918428836 1:184437514-184437536 GCAGTAAGGTCAAGGTGGGCAGG + Intronic
919330817 1:196168626-196168648 TCCCAAAGTAGAAGGTGTGCAGG + Intergenic
924652236 1:245940067-245940089 TCCCTGAGGGGAAGGTGAGGAGG - Intronic
1062987812 10:1785648-1785670 GCCCTAAGCTGGAGGAGGGCGGG + Intergenic
1063936917 10:11087857-11087879 TTCCAAAGGAGAAGGAGGGCCGG + Intronic
1064150205 10:12856511-12856533 TCCCTCAGCTGCAGGTGTGCTGG - Intergenic
1066697871 10:38094665-38094687 TCCCTGAGGTGAAGGATGCCCGG + Intronic
1066994635 10:42552528-42552550 TCCCTGAGGTGAAGGATGCCCGG - Intergenic
1067454815 10:46411888-46411910 TCACTAATGTGATGGAGGGCAGG - Intergenic
1067570946 10:47370388-47370410 TCCCTAAGGAAAAGCTGGGTGGG - Intronic
1067632389 10:47972746-47972768 TCACTAATGTGATGGAGGGCAGG + Intergenic
1073486783 10:103824177-103824199 GCCCCAAGGGGAGGGTGGGCAGG + Intronic
1073523854 10:104161340-104161362 TGACTTAGGTGAAGGTGAGCAGG + Intronic
1076437940 10:130459389-130459411 TCCCCAAGGTGAAGGGGGAGGGG + Intergenic
1076437974 10:130459545-130459567 TCCCTAAGGTGAAGAGGGAGGGG + Intergenic
1076438035 10:130459804-130459826 TCCCTAAGGTGAAGAGGGAGGGG + Intergenic
1077457678 11:2690750-2690772 TCCCTTAGGTGGATGTGGCCTGG + Intronic
1079744929 11:24113888-24113910 TCCCTCATGTGAAGGTGGTACGG + Intergenic
1081804451 11:45882867-45882889 TCCCTAAGGTACAGGTTGGCAGG + Exonic
1082284158 11:50301616-50301638 TCCCTAAGCCCAAAGTGGGCAGG + Intergenic
1083156840 11:60828571-60828593 TCCCTGAGGAGAAGGTTGCCCGG - Intergenic
1083475153 11:62910527-62910549 TGCCAAAGGTGATGATGGGCTGG + Exonic
1084343190 11:68523091-68523113 TCCAAAAGGTGAAGGAGGGAAGG - Intronic
1084366833 11:68706936-68706958 TCCCAAGGGTGAAGGAGGCCAGG + Intergenic
1085303729 11:75473544-75473566 GCCCTCAGGTGGAGGTGGGAGGG - Intronic
1085714847 11:78863193-78863215 GCCATAAGGGAAAGGTGGGCAGG + Intronic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1088539944 11:110903017-110903039 TCCCTAAGGGGAGGATGGGGTGG - Intergenic
1089176418 11:116552049-116552071 GAGCTAGGGTGAAGGTGGGCAGG - Intergenic
1089576510 11:119448066-119448088 TACCTGGGGTGAAGGTGGGTGGG + Intergenic
1090277331 11:125429370-125429392 TCTCTGAAGTGCAGGTGGGCTGG - Intronic
1091241970 11:134059051-134059073 TCCCTCAGGGGAAGGTGGCCAGG - Intergenic
1091272688 11:134328891-134328913 TCCATAAGGAGGAGGTGGGGAGG + Intergenic
1091397107 12:160686-160708 AAGCGAAGGTGAAGGTGGGCTGG - Intronic
1096714421 12:53482724-53482746 TCCCCCAGGTGAATCTGGGCTGG + Exonic
1097231725 12:57516415-57516437 TCCCTAAGATAAAGGGGGGTGGG - Exonic
1103167435 12:118782564-118782586 TCACTAAGGGGAAGGTGCACTGG - Intergenic
1103587831 12:121969302-121969324 TCTCTCAGGTGAAGGTGGGGTGG - Intronic
1104140970 12:125985101-125985123 TCCCTGTGGTGATGATGGGCTGG + Intergenic
1104732802 12:131117691-131117713 TCCATGAGGTCCAGGTGGGCTGG - Intronic
1105481984 13:20786144-20786166 GCCCTAAGCTGAAGGTGCCCTGG - Intronic
1107152520 13:37128603-37128625 TCCCAAAGGTGAATGAGGCCTGG + Intergenic
1109944915 13:69420718-69420740 TCCTTGACCTGAAGGTGGGCAGG + Intergenic
1111211999 13:85091598-85091620 TCCCTTAAGTGAAGGTGTCCTGG + Intergenic
1111932707 13:94527521-94527543 TCCCTAAGCTGCAGGTCTGCTGG - Intergenic
1112641014 13:101275149-101275171 ACCCAAAGGTGAAGGTGCACTGG - Intronic
1112759425 13:102677318-102677340 TCCCTGATGTGAACGTCGGCAGG - Intronic
1114014803 14:18418046-18418068 TCTCTAAGGTGAAGCTTGGTGGG + Intergenic
1119243483 14:73082631-73082653 TCCAAAATGTGAAGGAGGGCAGG - Intronic
1119998539 14:79278764-79278786 TCCCAAAAGTGAAGGTGGAGCGG - Intronic
1122280320 14:100618431-100618453 TGCCTACGATGAGGGTGGGCAGG - Intergenic
1122427936 14:101622586-101622608 TGCCTCAGGTGACGGTGGGATGG - Intergenic
1124340658 15:28887414-28887436 TTCCTAAGGTGCAGGTTGGCAGG + Intronic
1124966431 15:34436193-34436215 TTCCTAAGGTGCAGGTTGGCAGG - Intronic
1125410426 15:39400392-39400414 TCACCAAGGAGCAGGTGGGCAGG + Intergenic
1125603678 15:40928551-40928573 TCCCTGAGGTGGGGGAGGGCGGG - Intergenic
1128145257 15:65329307-65329329 TGGCCAAGGTGAAGGGGGGCAGG + Intronic
1129038590 15:72665612-72665634 TCCCGAAGGAGAAGGCGGACGGG + Exonic
1129211300 15:74071618-74071640 TCCCGAAGGAGAAGGCGGACGGG - Exonic
1129387507 15:75203782-75203804 TCCCAAGGGTGGAGGTGGGGAGG + Intronic
1129399103 15:75269469-75269491 TCCCGAAGGAGAAGGCGGACGGG + Exonic
1129402710 15:75293745-75293767 TCCCGAAGGAGAAGGCGGACGGG + Exonic
1129476242 15:75786167-75786189 TCCCGAAGGAGAAGGTGGGCAGG + Intergenic
1129740502 15:77987436-77987458 TCCCTAATTTGGAGGTGGGATGG + Intronic
1131711279 15:95059346-95059368 TTCCTCAGGTGATGGTTGGCGGG + Intergenic
1133654430 16:7846608-7846630 TCCCCAAGGGGAAGATGGGAGGG - Intergenic
1134599890 16:15525126-15525148 TCCCTAATGTAGAGGTGGGTGGG + Intronic
1135916680 16:26611140-26611162 TCCCTGATGGAAAGGTGGGCTGG - Intergenic
1136022883 16:27451133-27451155 TCCCTAGGGTGCAGGTGCACGGG - Exonic
1138109380 16:54311466-54311488 CCCCTAATGAGAAGGTGGCCGGG - Intergenic
1139490805 16:67285019-67285041 TTCCTCAGGGGAGGGTGGGCAGG - Exonic
1139580251 16:67868951-67868973 GCCCTAAGGTCAAGGTGGACAGG + Intronic
1140740076 16:77933725-77933747 GCCCTGAGGTGACAGTGGGCTGG + Intronic
1142639899 17:1279864-1279886 TCCCTCAGGAGACGGAGGGCCGG - Exonic
1145930037 17:28678801-28678823 CCACTAAGGTGAAGTAGGGCAGG - Exonic
1146800188 17:35812829-35812851 ACCCTAAGATCAAGGTTGGCCGG + Intronic
1148809877 17:50283627-50283649 GCCCTAAGGAGCAGGAGGGCTGG - Intergenic
1150482237 17:65519530-65519552 TCCCTAAAGTGAGGTTGGGAGGG + Intergenic
1150984261 17:70177545-70177567 TCCCTAAGGTGAAGGTGGGCTGG - Exonic
1151829301 17:76540279-76540301 CCACCAAGCTGAAGGTGGGCAGG + Intronic
1156406908 18:36791435-36791457 ACCCTGAGGTGGAGGTGGACTGG + Intronic
1158793403 18:60810709-60810731 TCCATAAGTTAAATGTGGGCAGG - Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1161428284 19:4216449-4216471 TCCCTGAGGTCAGGGTGGGCAGG + Intronic
1163784456 19:19267612-19267634 ACCCTAAGGTGCAGGTGAGAGGG - Exonic
1165100972 19:33438554-33438576 GCCCTGAGGTGATGGGGGGCGGG + Intronic
1165845724 19:38816618-38816640 TCACTGGGGTGAAGGTGGGGCGG - Intronic
925026540 2:611907-611929 TGCTTAAGGTGAGGGTGGGGAGG + Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
927152688 2:20204831-20204853 TCCCTGAGCTGGAGGTGGTCAGG - Intronic
927504728 2:23605392-23605414 TCCATAAGGGGCAGGTAGGCGGG - Intronic
929439650 2:41955189-41955211 GCCCAAAGGTGAAGGAGGGCTGG - Intergenic
929819189 2:45259737-45259759 TCCCCAAAGGGAAGGTGGGCAGG + Intergenic
933773201 2:85756410-85756432 TCCCTAGTGGCAAGGTGGGCAGG - Intronic
939239783 2:139542884-139542906 TTCCTAAGACGATGGTGGGCAGG + Intergenic
940083039 2:149826309-149826331 TTCCCAAGGTGAATGTGGGCTGG - Intergenic
941692875 2:168519520-168519542 TCCAAAAGGGGAAGGTGGGGAGG - Intronic
945668345 2:212770359-212770381 TCCCTCAGGTGGAGTTGGGGAGG + Intergenic
946029365 2:216692636-216692658 CCCCCAAGATGAAGGCGGGCAGG + Intronic
947267869 2:228302747-228302769 TCCCTAAGCTCAAGCTGGGAAGG - Intergenic
947715159 2:232335601-232335623 TGCCTCAGCTGAAGGTGGCCTGG + Intronic
948813281 2:240496670-240496692 ACCCTAAGGTGACGGTGGTTTGG + Intronic
1168755796 20:316768-316790 TACCTCAGGTGAAGGAAGGCAGG + Intergenic
1171348638 20:24486025-24486047 CCCTCCAGGTGAAGGTGGGCAGG + Intronic
1173256039 20:41394943-41394965 GCCCTAGGGTGAAGATGGGAGGG + Intergenic
1173331658 20:42080487-42080509 CTCCTAAGGAGAAGGAGGGCAGG + Exonic
1175916120 20:62426883-62426905 TCCCGGAGGTGGAGGTGGGCCGG + Intronic
1177291923 21:19123771-19123793 TAACTAAGGGGCAGGTGGGCAGG + Intergenic
1179128752 21:38615402-38615424 TCCCTTAGGTGAAGGTGGGAAGG + Intronic
1179209374 21:39313011-39313033 TCCCTCAGGGCAAGGTCGGCAGG + Intronic
1180078233 21:45473902-45473924 TCGCTGAGCTGAAGGTGCGCAGG + Exonic
1180085188 21:45505165-45505187 TCCCTGAGGTCCAGGTGGGCCGG - Exonic
1180439302 22:15348819-15348841 TCTCTAAGGTGAAGCTTGGTGGG + Intergenic
1181013844 22:20057191-20057213 CCCCTAAGATGCAGGTGGGATGG - Intronic
1182936704 22:34229582-34229604 TCCCTAAGGTGGAGAGGGCCTGG - Intergenic
1183271972 22:36867947-36867969 TCCCTTACGTGAACATGGGCTGG + Intronic
1183562150 22:38583677-38583699 TCCATATGGTGAAGCAGGGCAGG + Intronic
1183976527 22:41515528-41515550 GCCCCAAGGTGAGGGTGGGGAGG + Exonic
1184298406 22:43540707-43540729 TCCCTGGGATGAAGGTGGGTGGG - Intronic
1185135980 22:49072891-49072913 TCCTTATGGTGAAGCAGGGCAGG + Intergenic
950674794 3:14548206-14548228 GCCCTAAAGAGCAGGTGGGCTGG + Intergenic
951473181 3:23078054-23078076 AGCCTAAAGTGAAGTTGGGCAGG - Intergenic
952219704 3:31312811-31312833 TCCCTAATATGAAGGTGGAGTGG - Intergenic
954574699 3:51669516-51669538 AGCCTGAGGTGAAGCTGGGCAGG + Intronic
956929653 3:74028608-74028630 TCCCTAGAGGGAAGGTGGACTGG + Intergenic
958845466 3:99260054-99260076 TCCCTAAGGGGTAGCAGGGCTGG + Intergenic
961305156 3:125953783-125953805 TCCCTCTGCTGAAGGAGGGCGGG + Intergenic
961701668 3:128749428-128749450 TCGCTAAGGTGAAGCTGGCCTGG - Intronic
961741004 3:129033099-129033121 TCCCTCAGGGGGAGGTGGGAAGG + Intronic
963679484 3:148355893-148355915 TCCCTGAGGGGAAGGTGAGAAGG - Intergenic
964747184 3:160023347-160023369 TCCCCAGGGGCAAGGTGGGCTGG + Intronic
964756293 3:160093054-160093076 TCCCTAAGGTTAATGAGGTCAGG - Intergenic
966265600 3:178038092-178038114 TGCATAAGCTGAAGGTGGGAAGG - Intergenic
967547642 3:190750724-190750746 TCTCAAATGTGAAGGTGGTCTGG + Intergenic
968659358 4:1792859-1792881 TTCCTCAGGTGGAGGAGGGCAGG - Intergenic
969595636 4:8148036-8148058 TCCCTGAGGCCCAGGTGGGCAGG + Intronic
970451065 4:16166866-16166888 TGGCTAAGGAGAAGGTGGGGGGG + Intronic
971324611 4:25633764-25633786 TCAGTATGGTGAAGGTGGCCTGG + Intergenic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
976651053 4:87435112-87435134 TTCCTAATGAGAAAGTGGGCTGG + Exonic
982037703 4:151362593-151362615 TACCTAAGGGCAAGGTGAGCAGG + Intergenic
983412886 4:167421308-167421330 TCCCTAAGCTCAAGCTGGGAAGG + Intergenic
986406837 5:7434455-7434477 TCTCTAAGGTGAAGGTGGCTTGG - Intronic
988975268 5:36508913-36508935 TCCCTCAGGTGCAGGTGTGTTGG - Intergenic
992205537 5:74427147-74427169 TCCCTGAGGTTAGGGAGGGCAGG - Intergenic
996996273 5:129700160-129700182 TTCCTAAAGTGAATTTGGGCAGG + Intronic
999047193 5:148482174-148482196 CCCCCAAGGTGCAGGAGGGCAGG - Exonic
999398855 5:151249144-151249166 TCCCTAAGGTGTAGCAGGGCTGG + Intronic
1000201978 5:159020161-159020183 GCCATAAGTTTAAGGTGGGCTGG - Intronic
1001220206 5:169894231-169894253 TGCCCAAGATGAAGGTGGTCTGG + Intronic
1001442180 5:171751369-171751391 TCCCTAAGTAGAAGGTGGTTAGG - Intergenic
1003962268 6:11219780-11219802 TCCCAAAGGTGATGGTGGGAAGG - Intronic
1004720840 6:18266154-18266176 TCCCTGGCTTGAAGGTGGGCAGG + Intergenic
1006832912 6:36979629-36979651 TGCCTGAGATGAGGGTGGGCTGG + Intronic
1007398429 6:41590163-41590185 CTCCTCAGGTGAGGGTGGGCTGG + Exonic
1008029406 6:46676716-46676738 TGCCCAAGGTGAAAGTGGTCAGG - Exonic
1013212923 6:108002808-108002830 TCCCTATGGGGAAGGAGGGAGGG - Intergenic
1015020834 6:128472422-128472444 TCCCTAAGCTAAAGGGGGGGGGG - Intronic
1015400707 6:132785212-132785234 CCCCTAAGGGGATGGAGGGCTGG + Intronic
1016792124 6:148077073-148077095 TCCCCAAAGTGGAGGTGTGCAGG - Intergenic
1018115993 6:160585919-160585941 TGCCCAAGATGAAGGTAGGCTGG + Intronic
1018174074 6:161164042-161164064 TCCCTATGCTGCAGGTGGGATGG + Intronic
1019117147 6:169774413-169774435 TTACGAAGGTGGAGGTGGGCAGG + Intronic
1023027617 7:36065119-36065141 TCCCTGAGGTGGAAGTGGACTGG + Intergenic
1024347492 7:48327846-48327868 TCCCAAAGGTGAAGGCAGTCAGG - Intronic
1028011616 7:85650552-85650574 GTCCTATAGTGAAGGTGGGCAGG + Intergenic
1028175917 7:87657896-87657918 TCCCACAGGGGAAGGTGGGAGGG - Intronic
1029361779 7:100093399-100093421 TGCCTAAGGGGAAGGTAGGGGGG + Exonic
1029628084 7:101732962-101732984 TCCCTGCTGTGAAGCTGGGCTGG + Intergenic
1031697304 7:124874202-124874224 TCCCTAATGTGATGGTGAGGAGG - Intronic
1033115055 7:138617832-138617854 TCTTTAAGGTGGAGGTGGGGAGG + Intronic
1034101817 7:148457276-148457298 TCCCTGGCTTGAAGGTGGGCAGG + Intergenic
1035023573 7:155812637-155812659 TTCCTAAGATAAAGGTGGGCGGG + Intergenic
1042215973 8:66429847-66429869 TCCCCAAGGAGAAGGTGCCCCGG + Exonic
1042947749 8:74171996-74172018 TCTCTAAGTTGAAGCTGGGGTGG - Intergenic
1043259462 8:78179153-78179175 TCCCTAAGGTGTAATAGGGCTGG + Intergenic
1043684028 8:83065899-83065921 TCTCTAAGGGGAAGCAGGGCTGG - Intergenic
1044016180 8:87050934-87050956 TCCTTAAGGTGAATCTGGACTGG + Intronic
1044866271 8:96574071-96574093 TCCCAAAGCTGAAGGTGAGTTGG - Intronic
1047347250 8:124040225-124040247 TCCCTGAGGCGAAGGAAGGCTGG + Intronic
1047693990 8:127384909-127384931 GCACTAAGGTGAAGGCTGGCTGG + Intergenic
1048328530 8:133456575-133456597 TCCCTGGGGTGAAGGTGGCTGGG - Exonic
1049498744 8:142949743-142949765 GCCCTATGGTGAAGGTGGAAGGG - Intergenic
1050969208 9:11847097-11847119 TCCCTAAGGTGAAGGAGGCAGGG - Intergenic
1056710500 9:88989175-88989197 ACCCTTAGGTGAAAGTGTGCAGG - Intergenic
1056943429 9:90974578-90974600 TCTCTTAGGTGAAGGTGAGAGGG + Intergenic
1057242386 9:93422996-93423018 TCCCCAAGGTTCAGCTGGGCAGG - Intergenic
1058592334 9:106578263-106578285 TCCCTGAGGTGACAGAGGGCAGG + Intergenic
1058814524 9:108670979-108671001 TCCCTGAGATGCAGGTGGGGAGG - Intergenic
1058872547 9:109215082-109215104 GCCCCAAGGTGAAGGTTGGATGG + Intronic
1060341438 9:122780147-122780169 TCCTAGAGGTGAGGGTGGGCGGG + Intergenic
1060979337 9:127783733-127783755 TCCCTAAATTGGAGGTGGGGAGG - Intergenic
1060995673 9:127873883-127873905 TCCCCAGGGAGGAGGTGGGCTGG + Intronic
1061777179 9:132973305-132973327 TCCGGCAGGTGCAGGTGGGCTGG - Intronic
1062706184 9:137944765-137944787 TCCCTAAGGGGTAGCAGGGCTGG + Intronic
1187353991 X:18549731-18549753 TCCCTAAGGTGATGGGGGCGGGG - Intronic
1189994373 X:46624987-46625009 TCCAGAAGGTGAAGGTGGCGAGG + Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1190688240 X:52892807-52892829 TCCCTCAGGTGAGGGTAGGGTGG - Intronic
1190697742 X:52962985-52963007 TCCCTCAGGTGAGGGTAGGGTGG + Intronic
1195721810 X:107875497-107875519 TCCTTAAGGTGAACCTGGACTGG + Intronic
1200014211 X:153146834-153146856 TCCCAAAGGAGAAGGGTGGCTGG + Intergenic
1200025389 X:153253118-153253140 TCCCAAAGGAGAAGGGTGGCTGG - Intergenic
1201337116 Y:12893086-12893108 TCCTTAAGGTGAATCTGGACTGG - Intergenic