ID: 1150988549

View in Genome Browser
Species Human (GRCh38)
Location 17:70227879-70227901
Sequence CCCAAAATTATAGGATTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150988549_1150988552 -10 Left 1150988549 17:70227879-70227901 CCTTACAATCCTATAATTTTGGG No data
Right 1150988552 17:70227892-70227914 TAATTTTGGGTTCAAATAGAAGG No data
1150988549_1150988553 -3 Left 1150988549 17:70227879-70227901 CCTTACAATCCTATAATTTTGGG No data
Right 1150988553 17:70227899-70227921 GGGTTCAAATAGAAGGAGTAAGG No data
1150988549_1150988555 24 Left 1150988549 17:70227879-70227901 CCTTACAATCCTATAATTTTGGG No data
Right 1150988555 17:70227926-70227948 TCTGGATAAACTTTGTTTTAAGG No data
1150988549_1150988554 6 Left 1150988549 17:70227879-70227901 CCTTACAATCCTATAATTTTGGG No data
Right 1150988554 17:70227908-70227930 TAGAAGGAGTAAGGTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150988549 Original CRISPR CCCAAAATTATAGGATTGTA AGG (reversed) Intergenic
No off target data available for this crispr