ID: 1150988552

View in Genome Browser
Species Human (GRCh38)
Location 17:70227892-70227914
Sequence TAATTTTGGGTTCAAATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150988549_1150988552 -10 Left 1150988549 17:70227879-70227901 CCTTACAATCCTATAATTTTGGG No data
Right 1150988552 17:70227892-70227914 TAATTTTGGGTTCAAATAGAAGG No data
1150988547_1150988552 -4 Left 1150988547 17:70227873-70227895 CCGCAGCCTTACAATCCTATAAT No data
Right 1150988552 17:70227892-70227914 TAATTTTGGGTTCAAATAGAAGG No data
1150988546_1150988552 25 Left 1150988546 17:70227844-70227866 CCAAAATGAGGGCTAGGAGTAAG No data
Right 1150988552 17:70227892-70227914 TAATTTTGGGTTCAAATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150988552 Original CRISPR TAATTTTGGGTTCAAATAGA AGG Intergenic
No off target data available for this crispr