ID: 1150988555

View in Genome Browser
Species Human (GRCh38)
Location 17:70227926-70227948
Sequence TCTGGATAAACTTTGTTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150988549_1150988555 24 Left 1150988549 17:70227879-70227901 CCTTACAATCCTATAATTTTGGG No data
Right 1150988555 17:70227926-70227948 TCTGGATAAACTTTGTTTTAAGG No data
1150988551_1150988555 15 Left 1150988551 17:70227888-70227910 CCTATAATTTTGGGTTCAAATAG No data
Right 1150988555 17:70227926-70227948 TCTGGATAAACTTTGTTTTAAGG No data
1150988547_1150988555 30 Left 1150988547 17:70227873-70227895 CCGCAGCCTTACAATCCTATAAT No data
Right 1150988555 17:70227926-70227948 TCTGGATAAACTTTGTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150988555 Original CRISPR TCTGGATAAACTTTGTTTTA AGG Intergenic
No off target data available for this crispr