ID: 1150989944

View in Genome Browser
Species Human (GRCh38)
Location 17:70245553-70245575
Sequence TAAAATGATGATAATGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150989944_1150989946 9 Left 1150989944 17:70245553-70245575 CCATTATCATTATCATCATTTTA No data
Right 1150989946 17:70245585-70245607 TGATGAGCCCAGAAAGGTTGAGG No data
1150989944_1150989949 25 Left 1150989944 17:70245553-70245575 CCATTATCATTATCATCATTTTA No data
Right 1150989949 17:70245601-70245623 GTTGAGGCTGCAGAGAGTCTTGG No data
1150989944_1150989945 3 Left 1150989944 17:70245553-70245575 CCATTATCATTATCATCATTTTA No data
Right 1150989945 17:70245579-70245601 TATACTTGATGAGCCCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150989944 Original CRISPR TAAAATGATGATAATGATAA TGG (reversed) Intergenic
No off target data available for this crispr