ID: 1150991800

View in Genome Browser
Species Human (GRCh38)
Location 17:70268444-70268466
Sequence TAAGGGTGTTAAGAACCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150991800_1150991803 15 Left 1150991800 17:70268444-70268466 CCTGCAGGTTCTTAACACCCTTA No data
Right 1150991803 17:70268482-70268504 CAACTCACATAGTTAAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150991800 Original CRISPR TAAGGGTGTTAAGAACCTGC AGG (reversed) Intergenic
No off target data available for this crispr