ID: 1150993501

View in Genome Browser
Species Human (GRCh38)
Location 17:70288493-70288515
Sequence TGGACCAAGGGACCACAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150993497_1150993501 23 Left 1150993497 17:70288447-70288469 CCTCATATAACAAGGTAGGGGAA No data
Right 1150993501 17:70288493-70288515 TGGACCAAGGGACCACAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150993501 Original CRISPR TGGACCAAGGGACCACAAGA TGG Intergenic
No off target data available for this crispr