ID: 1150994818

View in Genome Browser
Species Human (GRCh38)
Location 17:70305250-70305272
Sequence CTGGTTTGCCAGGACTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150994818_1150994824 5 Left 1150994818 17:70305250-70305272 CCCACTGAGTCCTGGCAAACCAG No data
Right 1150994824 17:70305278-70305300 AGAGTCATAAGCACATTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150994818 Original CRISPR CTGGTTTGCCAGGACTCAGT GGG (reversed) Intergenic
No off target data available for this crispr