ID: 1150994824

View in Genome Browser
Species Human (GRCh38)
Location 17:70305278-70305300
Sequence AGAGTCATAAGCACATTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150994820_1150994824 -5 Left 1150994820 17:70305260-70305282 CCTGGCAAACCAGCCCACAGAGT No data
Right 1150994824 17:70305278-70305300 AGAGTCATAAGCACATTAAGTGG No data
1150994819_1150994824 4 Left 1150994819 17:70305251-70305273 CCACTGAGTCCTGGCAAACCAGC No data
Right 1150994824 17:70305278-70305300 AGAGTCATAAGCACATTAAGTGG No data
1150994818_1150994824 5 Left 1150994818 17:70305250-70305272 CCCACTGAGTCCTGGCAAACCAG No data
Right 1150994824 17:70305278-70305300 AGAGTCATAAGCACATTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150994824 Original CRISPR AGAGTCATAAGCACATTAAG TGG Intergenic
No off target data available for this crispr