ID: 1150996183

View in Genome Browser
Species Human (GRCh38)
Location 17:70320283-70320305
Sequence CAATTTGGCTAGTGGGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150996183_1150996190 10 Left 1150996183 17:70320283-70320305 CCAACTGCCCACTAGCCAAATTG No data
Right 1150996190 17:70320316-70320338 GACGAGTAACATTTAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150996183 Original CRISPR CAATTTGGCTAGTGGGCAGT TGG (reversed) Intergenic
No off target data available for this crispr