ID: 1151005313

View in Genome Browser
Species Human (GRCh38)
Location 17:70429392-70429414
Sequence TGTTAGCTATAGGATTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151005313_1151005316 11 Left 1151005313 17:70429392-70429414 CCACAAAAATCCTATAGCTAACA No data
Right 1151005316 17:70429426-70429448 TCAAAACATATGCATGTTCAGGG No data
1151005313_1151005315 10 Left 1151005313 17:70429392-70429414 CCACAAAAATCCTATAGCTAACA No data
Right 1151005315 17:70429425-70429447 CTCAAAACATATGCATGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151005313 Original CRISPR TGTTAGCTATAGGATTTTTG TGG (reversed) Intergenic
No off target data available for this crispr