ID: 1151006608

View in Genome Browser
Species Human (GRCh38)
Location 17:70445017-70445039
Sequence GGTGTTTAGGGACCAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151006608_1151006617 28 Left 1151006608 17:70445017-70445039 CCAGATTTTGGTCCCTAAACACC No data
Right 1151006617 17:70445068-70445090 ATGCAGAAGTGGTTGATTCCAGG No data
1151006608_1151006615 17 Left 1151006608 17:70445017-70445039 CCAGATTTTGGTCCCTAAACACC No data
Right 1151006615 17:70445057-70445079 ACCAGGGCTCAATGCAGAAGTGG No data
1151006608_1151006611 -7 Left 1151006608 17:70445017-70445039 CCAGATTTTGGTCCCTAAACACC No data
Right 1151006611 17:70445033-70445055 AAACACCATTCTTCTGTCAAAGG No data
1151006608_1151006618 29 Left 1151006608 17:70445017-70445039 CCAGATTTTGGTCCCTAAACACC No data
Right 1151006618 17:70445069-70445091 TGCAGAAGTGGTTGATTCCAGGG No data
1151006608_1151006613 0 Left 1151006608 17:70445017-70445039 CCAGATTTTGGTCCCTAAACACC No data
Right 1151006613 17:70445040-70445062 ATTCTTCTGTCAAAGGAACCAGG No data
1151006608_1151006614 1 Left 1151006608 17:70445017-70445039 CCAGATTTTGGTCCCTAAACACC No data
Right 1151006614 17:70445041-70445063 TTCTTCTGTCAAAGGAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151006608 Original CRISPR GGTGTTTAGGGACCAAAATC TGG (reversed) Intergenic
No off target data available for this crispr