ID: 1151011453

View in Genome Browser
Species Human (GRCh38)
Location 17:70502683-70502705
Sequence TATTCTTACTTTTAACTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151011452_1151011453 19 Left 1151011452 17:70502641-70502663 CCATCTAGAAGGTTTATAAACAT No data
Right 1151011453 17:70502683-70502705 TATTCTTACTTTTAACTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151011453 Original CRISPR TATTCTTACTTTTAACTGCT TGG Intergenic
No off target data available for this crispr