ID: 1151012016

View in Genome Browser
Species Human (GRCh38)
Location 17:70510511-70510533
Sequence GCCTAACACCAGAAGCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151012016_1151012017 -6 Left 1151012016 17:70510511-70510533 CCATGTGGCTTCTGGTGTTAGGC No data
Right 1151012017 17:70510528-70510550 TTAGGCCATGAAAGACATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151012016 Original CRISPR GCCTAACACCAGAAGCCACA TGG (reversed) Intergenic
No off target data available for this crispr