ID: 1151017843

View in Genome Browser
Species Human (GRCh38)
Location 17:70577585-70577607
Sequence CGGCGAACAGCAGTGGTGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151017843_1151017853 23 Left 1151017843 17:70577585-70577607 CCGTTCACCACTGCTGTTCGCCG No data
Right 1151017853 17:70577631-70577653 TCCACACCCCCGGATCCGGCAGG No data
1151017843_1151017852 19 Left 1151017843 17:70577585-70577607 CCGTTCACCACTGCTGTTCGCCG No data
Right 1151017852 17:70577627-70577649 GACTTCCACACCCCCGGATCCGG No data
1151017843_1151017851 13 Left 1151017843 17:70577585-70577607 CCGTTCACCACTGCTGTTCGCCG No data
Right 1151017851 17:70577621-70577643 ACTGTTGACTTCCACACCCCCGG No data
1151017843_1151017855 24 Left 1151017843 17:70577585-70577607 CCGTTCACCACTGCTGTTCGCCG No data
Right 1151017855 17:70577632-70577654 CCACACCCCCGGATCCGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151017843 Original CRISPR CGGCGAACAGCAGTGGTGAA CGG (reversed) Intergenic
No off target data available for this crispr