ID: 1151018207

View in Genome Browser
Species Human (GRCh38)
Location 17:70581634-70581656
Sequence TGTGTTGATCATTAGAGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151018207_1151018208 -2 Left 1151018207 17:70581634-70581656 CCAATACTCTAATGATCAACACA No data
Right 1151018208 17:70581655-70581677 CAAGAAACCACCGATTAAATCGG No data
1151018207_1151018211 10 Left 1151018207 17:70581634-70581656 CCAATACTCTAATGATCAACACA No data
Right 1151018211 17:70581667-70581689 GATTAAATCGGTAGATACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151018207 Original CRISPR TGTGTTGATCATTAGAGTAT TGG (reversed) Intergenic
No off target data available for this crispr