ID: 1151018208

View in Genome Browser
Species Human (GRCh38)
Location 17:70581655-70581677
Sequence CAAGAAACCACCGATTAAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151018207_1151018208 -2 Left 1151018207 17:70581634-70581656 CCAATACTCTAATGATCAACACA No data
Right 1151018208 17:70581655-70581677 CAAGAAACCACCGATTAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151018208 Original CRISPR CAAGAAACCACCGATTAAAT CGG Intergenic
No off target data available for this crispr