ID: 1151024293

View in Genome Browser
Species Human (GRCh38)
Location 17:70659162-70659184
Sequence CTGTGTAACTATGAGGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151024291_1151024293 20 Left 1151024291 17:70659119-70659141 CCATGCTATGTCTAGGGATATGA No data
Right 1151024293 17:70659162-70659184 CTGTGTAACTATGAGGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151024293 Original CRISPR CTGTGTAACTATGAGGATGT TGG Intergenic
No off target data available for this crispr