ID: 1151036478

View in Genome Browser
Species Human (GRCh38)
Location 17:70805960-70805982
Sequence CCGTATGGCCATCTTGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151036474_1151036478 3 Left 1151036474 17:70805934-70805956 CCATGCTGTTTGGCTTAGGACTA No data
Right 1151036478 17:70805960-70805982 CCGTATGGCCATCTTGTTCATGG No data
1151036470_1151036478 27 Left 1151036470 17:70805910-70805932 CCATTAGGTTTAATTAAAGGGAG No data
Right 1151036478 17:70805960-70805982 CCGTATGGCCATCTTGTTCATGG No data
1151036473_1151036478 4 Left 1151036473 17:70805933-70805955 CCCATGCTGTTTGGCTTAGGACT No data
Right 1151036478 17:70805960-70805982 CCGTATGGCCATCTTGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151036478 Original CRISPR CCGTATGGCCATCTTGTTCA TGG Intergenic
No off target data available for this crispr