ID: 1151039523

View in Genome Browser
Species Human (GRCh38)
Location 17:70842500-70842522
Sequence CTGTGGTGCCATGTATTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151039523_1151039527 2 Left 1151039523 17:70842500-70842522 CCAGGGAATACATGGCACCACAG No data
Right 1151039527 17:70842525-70842547 AAAACACTGTTCATCTTTCTGGG No data
1151039523_1151039526 1 Left 1151039523 17:70842500-70842522 CCAGGGAATACATGGCACCACAG No data
Right 1151039526 17:70842524-70842546 AAAAACACTGTTCATCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151039523 Original CRISPR CTGTGGTGCCATGTATTCCC TGG (reversed) Intergenic
No off target data available for this crispr