ID: 1151049292

View in Genome Browser
Species Human (GRCh38)
Location 17:70958439-70958461
Sequence CCTTGGCCTGCTTTTTAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151049286_1151049292 16 Left 1151049286 17:70958400-70958422 CCACATGTATGTCTTCTTTTGAA 0: 440
1: 1028
2: 1915
3: 5291
4: 6674
Right 1151049292 17:70958439-70958461 CCTTGGCCTGCTTTTTAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151049292 Original CRISPR CCTTGGCCTGCTTTTTAATG GGG Intergenic
No off target data available for this crispr