ID: 1151050711

View in Genome Browser
Species Human (GRCh38)
Location 17:70975767-70975789
Sequence TGGGTATGCACATATTATAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151050711_1151050712 -7 Left 1151050711 17:70975767-70975789 CCGGTATAATATGTGCATACCCA No data
Right 1151050712 17:70975783-70975805 ATACCCATTATTGATAAAGATGG No data
1151050711_1151050716 11 Left 1151050711 17:70975767-70975789 CCGGTATAATATGTGCATACCCA No data
Right 1151050716 17:70975801-70975823 GATGGAACATGGTCCATATAAGG No data
1151050711_1151050715 0 Left 1151050711 17:70975767-70975789 CCGGTATAATATGTGCATACCCA No data
Right 1151050715 17:70975790-70975812 TTATTGATAAAGATGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151050711 Original CRISPR TGGGTATGCACATATTATAC CGG (reversed) Intergenic
No off target data available for this crispr