ID: 1151052517

View in Genome Browser
Species Human (GRCh38)
Location 17:70994661-70994683
Sequence CATAGGACATTAATGGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151052511_1151052517 25 Left 1151052511 17:70994613-70994635 CCTCAAAATATAACATAGATCAA No data
Right 1151052517 17:70994661-70994683 CATAGGACATTAATGGTTACAGG No data
1151052514_1151052517 -10 Left 1151052514 17:70994648-70994670 CCATGAAAGAAACCATAGGACAT No data
Right 1151052517 17:70994661-70994683 CATAGGACATTAATGGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151052517 Original CRISPR CATAGGACATTAATGGTTAC AGG Intergenic
No off target data available for this crispr