ID: 1151054187

View in Genome Browser
Species Human (GRCh38)
Location 17:71012803-71012825
Sequence AAGGAGAAGCTTCAGTTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151054182_1151054187 23 Left 1151054182 17:71012757-71012779 CCACCTCATGAGCGAAGATTTGA 0: 1
1: 1
2: 2
3: 4
4: 53
Right 1151054187 17:71012803-71012825 AAGGAGAAGCTTCAGTTGATAGG 0: 1
1: 0
2: 0
3: 9
4: 170
1151054183_1151054187 20 Left 1151054183 17:71012760-71012782 CCTCATGAGCGAAGATTTGAAAA 0: 1
1: 1
2: 3
3: 12
4: 176
Right 1151054187 17:71012803-71012825 AAGGAGAAGCTTCAGTTGATAGG 0: 1
1: 0
2: 0
3: 9
4: 170
1151054185_1151054187 -4 Left 1151054185 17:71012784-71012806 CCACTTGAAGAAAAGGAAGAAGG 0: 1
1: 0
2: 5
3: 60
4: 453
Right 1151054187 17:71012803-71012825 AAGGAGAAGCTTCAGTTGATAGG 0: 1
1: 0
2: 0
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151054187 Original CRISPR AAGGAGAAGCTTCAGTTGAT AGG Intergenic
901329437 1:8393910-8393932 AATTAGAAGCTTCAGATGATAGG + Intronic
902453158 1:16512019-16512041 AAGGAGCAGTTTTATTTGATTGG - Intergenic
902473211 1:16664689-16664711 AAGGAGCAGTTTTATTTGATTGG - Intergenic
902485592 1:16742753-16742775 AAGGAGCAGTTTTATTTGATTGG + Intronic
903405318 1:23090827-23090849 AAGAAGCAGCTGCAGCTGATGGG - Intronic
904341941 1:29841177-29841199 GAGGAGAAGCATAAGGTGATTGG - Intergenic
904487309 1:30835312-30835334 AAGGCCAAGCTTCAGTTCATAGG + Intergenic
906288091 1:44601464-44601486 AAGGAGAAGATGCAGTAGAGAGG + Intronic
907995159 1:59623685-59623707 TAGGTGAAGCTTCAGCTGAGAGG - Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909258389 1:73454015-73454037 AAAAAGTAGCTGCAGTTGATAGG - Intergenic
911992965 1:104725977-104725999 AAGGAGAAGCTTCATGTCATTGG + Intergenic
916376152 1:164155444-164155466 AAGGAGCAGCTTGAGTAAATTGG - Intergenic
916521824 1:165570226-165570248 AAGGAGAAACTTCAACAGATGGG - Intergenic
916954744 1:169820342-169820364 AAGGGGAAACTTGAGCTGATGGG - Intronic
919130390 1:193443107-193443129 AAAGGGAAGCTTGAGCTGATAGG + Intergenic
919580017 1:199359775-199359797 AAAGAGAAGCTTTGGTAGATTGG - Intergenic
921580324 1:216889086-216889108 AGGGTGTAACTTCAGTTGATAGG - Intronic
923067119 1:230528126-230528148 AAGGAGTCCATTCAGTTGATTGG + Intergenic
1063701672 10:8390372-8390394 AAGGACACGCTTAAGATGATAGG + Intergenic
1063950452 10:11217558-11217580 AACTAGAACCTTCAGTTGAAAGG - Intronic
1067363008 10:45599654-45599676 AAGGAAAATCTTGAGTAGATTGG + Intergenic
1068427794 10:56889949-56889971 ATGGAGAAAATTCAGTGGATGGG - Intergenic
1070498638 10:77049099-77049121 AAGGAGCAGCTTAAGAAGATGGG + Intronic
1073275930 10:102311377-102311399 AAAGAGAAGCTGCAGGGGATGGG + Intronic
1073955667 10:108868633-108868655 AAGGTCAAGATTCAGTTGAAAGG - Intergenic
1075079719 10:119375267-119375289 AAGGAGAAGCTACAGTGGGGAGG - Intronic
1076036362 10:127201739-127201761 AAGGAGAGGCTGCAGTTGGGAGG - Intronic
1080615082 11:33938706-33938728 CAGGAGAAGGTTCAGGTGAGGGG - Intergenic
1081045058 11:38263607-38263629 AAGGGGAAGTTTTATTTGATTGG + Intergenic
1086125933 11:83348448-83348470 AAGGAGAAGCTTCTTTTGTATGG + Intergenic
1087873646 11:103329282-103329304 AAAGAGAGTCTTCAGGTGATGGG + Intronic
1089067005 11:115669823-115669845 TAGGAGAAGCTGCAGGTGAGTGG + Intergenic
1092142594 12:6194120-6194142 AAGGAGGAGCCCCAGGTGATGGG + Intergenic
1092307585 12:7317341-7317363 AAGGAGAAGTATCAGTTAGTTGG - Intronic
1093139581 12:15492697-15492719 ATTGAAAAGCTTCAGTAGATAGG + Intronic
1093987411 12:25551768-25551790 AAGTGGAAGGTTCAGGTGATGGG - Intronic
1095383039 12:41617201-41617223 AAGGAAGATCATCAGTTGATGGG - Intergenic
1098244055 12:68498172-68498194 AAGGAGAAACTTGCGTTGTTCGG - Intergenic
1100048705 12:90417200-90417222 AAGGATAATCTTCAATTAATGGG + Intergenic
1100760445 12:97801047-97801069 AAGGAGAAGAATAAGTTCATAGG - Intergenic
1100774913 12:97963249-97963271 AAGGAGAAGCTGAAACTGATGGG + Intergenic
1103358745 12:120341616-120341638 AAAGAGAAGCTGCATTTTATTGG - Exonic
1106722139 13:32446061-32446083 AAAGAGAATAGTCAGTTGATTGG + Intronic
1111404276 13:87782000-87782022 AAGTAGAAGCATCACCTGATTGG - Intergenic
1111840069 13:93438856-93438878 GAAGAGAAGATTCAATTGATAGG + Intronic
1112391825 13:98992181-98992203 CAGGATAAGCTTCAGGAGATGGG + Intronic
1113173565 13:107534785-107534807 GAGGAGAAGCTTCAGGTCAGTGG - Intronic
1115751733 14:36500303-36500325 GAAGAGATGCTTCAGTTGTTTGG + Intronic
1115813790 14:37140486-37140508 AAGGATAAGCCTCATTTTATAGG - Intronic
1115816363 14:37168557-37168579 AGGGATTAGCTACAGTTGATTGG + Intronic
1115923522 14:38405427-38405449 AAAGAGAGGATTCAGTTTATTGG + Intergenic
1119969555 14:78954451-78954473 CATGAGAAGCTTCAGTTTTTTGG + Intronic
1122455493 14:101847427-101847449 GAGGAGAGGCTGCAGTTGCTGGG - Intronic
1130418978 15:83722942-83722964 ATGGAGAAGCTTCAAATGAATGG + Intronic
1130467532 15:84200037-84200059 AGGGAGGAGCTTCAGTGCATGGG + Intergenic
1132941639 16:2511473-2511495 AAGGTGAAGACTCGGTTGATTGG + Intronic
1133563189 16:6968464-6968486 AGGGAGAAGCCTCAGTTTTTCGG - Intronic
1134662813 16:15997039-15997061 AAGGAGAAGCCTCTGTTGGAGGG + Intronic
1140315219 16:73889781-73889803 AAGGAGAAGAGTCAGTAGAAGGG - Intergenic
1142602591 17:1061468-1061490 AGGGAGATGCTTGAGTTGAAAGG + Intronic
1143839964 17:9724238-9724260 ATGGAGAAGCTTCAACTCATCGG + Intronic
1144579946 17:16452895-16452917 AAGGAGGAGCTGCAGCTGAGGGG - Intronic
1147041058 17:37719406-37719428 AAGGAGAAGAGTCAATTAATGGG + Intronic
1147165635 17:38591737-38591759 AAGGAGCAGTTTCAGCTGACTGG - Intronic
1148030620 17:44618040-44618062 AAGCAGAAGCTTCACTTCACTGG + Intergenic
1149776477 17:59361862-59361884 AAGCAGAAGCCTCAAATGATGGG + Intronic
1151054187 17:71012803-71012825 AAGGAGAAGCTTCAGTTGATAGG + Intergenic
1151653243 17:75483068-75483090 AAGGAGAAGCAAGAGTTGACTGG + Intronic
1155241019 18:23863654-23863676 AGGGAAAAGCTTCTGTTGAATGG + Intronic
1155755378 18:29488410-29488432 ATGAAGAAGCTTCAGTTTAAAGG + Intergenic
1157381950 18:47226495-47226517 AAGGAGAAGCTGGAATTGAGTGG - Intronic
1157612678 18:48968250-48968272 AGAGAGAATGTTCAGTTGATAGG - Intergenic
1159803890 18:72931085-72931107 ATAGAGAAGCTTCAGATTATAGG + Intergenic
1162637083 19:11977417-11977439 CAGGAGAAACTTCAGGTAATTGG + Exonic
1163351562 19:16779369-16779391 GAGGAGAAGCTGCTGGTGATTGG + Exonic
1164300602 19:23958806-23958828 AAGGAGAAGTATCAGTGCATTGG - Intergenic
1165936427 19:39391624-39391646 AAGGAGAGTCTACAGGTGATTGG + Exonic
1202705397 1_KI270713v1_random:19748-19770 AAGGAGCAGTTTTATTTGATTGG - Intergenic
925734880 2:6955340-6955362 GAGGGGAAGCCTTAGTTGATGGG - Intronic
925748690 2:7067749-7067771 TAGGAGAAGCTTCAGGTGACTGG - Intronic
928301544 2:30129754-30129776 TAGGAGAAGCTTCAGACAATGGG - Intergenic
929026347 2:37606937-37606959 AAGGAAAAGATTCAGAAGATGGG + Intergenic
932894287 2:75623581-75623603 TTGGAGATGCTTCAGTTGACTGG - Intergenic
935610663 2:105021626-105021648 AAGGAGAAGTGCCAGTTGTTTGG - Intergenic
935690082 2:105723193-105723215 AATGAGAAGCTCCAGCTGATTGG + Intergenic
936801328 2:116270001-116270023 AAGGAGGGATTTCAGTTGATGGG - Intergenic
940427926 2:153552158-153552180 AAAGAGAAGTTTCAGTGGAGTGG + Intergenic
940645215 2:156385111-156385133 AAGGAGTAGGTTCTGTTAATAGG + Intergenic
942399437 2:175585949-175585971 AAAGACAAGCTACAGTTGAATGG + Intergenic
943427770 2:187758515-187758537 AAAGAGAGGCTCCATTTGATTGG - Intergenic
944640754 2:201723058-201723080 AAGGAGAATTTTCAGATGACTGG - Exonic
944845525 2:203664289-203664311 AAGCAGAAACTTCAGGTGAGAGG - Intergenic
946678709 2:222190452-222190474 GAGTAGAAGCTTGACTTGATTGG - Intergenic
1169710376 20:8554932-8554954 AGGGAGAATCTTCAGTTTTTTGG - Intronic
1171103830 20:22412815-22412837 CAGGAGAAGTTTCAGTGGAAAGG - Intergenic
1172858328 20:38025801-38025823 AAAGAAAAACTTCAGTGGATGGG + Intronic
1174224467 20:48985710-48985732 AAACAAAAGCTTCAGTTGCTTGG - Intronic
1180308320 22:11148201-11148223 AAGGAGTAGCTCCAGATGAAAGG - Intergenic
1180546796 22:16510014-16510036 AAGGAGTAGCTCCAGATGAAAGG - Intergenic
1183652862 22:39168957-39168979 AAGGAGAAGCCTCAGCTCAGTGG - Intergenic
950198282 3:11025273-11025295 AAGGAGGAGCTTCAGATAAGTGG + Intronic
951356276 3:21670843-21670865 ACGGAGCAGCATCAGTTGTTTGG - Intronic
958146714 3:89632968-89632990 CAGGAGAAGCTGCTGTGGATTGG - Intergenic
960708085 3:120500689-120500711 AAGGAGGAGCTCCAGGTAATGGG - Intergenic
961916076 3:130376461-130376483 AAGAAGAACTTTCAGTTCATTGG + Exonic
964646502 3:158963697-158963719 AAGGAGAAGCAAAATTTGATGGG + Intronic
966416308 3:179693504-179693526 GATGAGAAGCATCAGTTGAGGGG - Intronic
966824178 3:183949917-183949939 ACGGAGAAGCCTCAGTTGCTGGG - Intronic
967006176 3:185385020-185385042 AAGGAAATGCTTCAGTACATGGG - Intronic
967351334 3:188516955-188516977 ACTGAGAGGCTTCAGTAGATGGG - Intronic
967781727 3:193447805-193447827 AAGAAGCATCCTCAGTTGATGGG - Intronic
968148633 3:196320165-196320187 ATGGAGAAGCTTCTCTTGCTGGG - Intronic
970018111 4:11535448-11535470 AAGGATCAGCTCCATTTGATGGG - Intergenic
971764470 4:30811833-30811855 AAGGAGAAGATTCAGATCACTGG + Intronic
972575490 4:40347409-40347431 AATGTGAAGCCTCAGTAGATTGG + Intronic
973801907 4:54486855-54486877 GAGGAGTGGCTTCATTTGATTGG + Intergenic
974499840 4:62684994-62685016 AGGAAGCAGCTTCAGATGATGGG + Intergenic
976882804 4:89949378-89949400 CAGGAGAAGTTTCAATTAATGGG - Intronic
977667343 4:99655978-99656000 AGGTAGATGCTTCAGTTGTTAGG - Intergenic
980764540 4:137283945-137283967 AAGGAGCACATTCTGTTGATTGG - Intergenic
981854463 4:149271546-149271568 TAGGAGAAGCTGCAGTTGGGAGG - Intergenic
982610195 4:157564406-157564428 AGTGAGAAGCTGCAGTTTATTGG + Intergenic
983889174 4:173013297-173013319 AAGGAAAAGCTTCATTTCTTGGG + Intronic
984944472 4:184960306-184960328 CAGAGGAAGCTTCAGTTGGTTGG + Intergenic
986306142 5:6518460-6518482 AAGGAAAAGTTAGAGTTGATAGG + Intergenic
990050384 5:51492989-51493011 AAGGAGAAACTCTGGTTGATAGG - Intergenic
990936095 5:61151065-61151087 AGGGAGAAGTTTCATTAGATGGG + Intronic
993029182 5:82684457-82684479 GAGGAGAAGGTTGACTTGATAGG - Intergenic
994426578 5:99595966-99595988 AAAGAGAAACTTGAGTTTATGGG - Intergenic
995061189 5:107813384-107813406 AAGAAGAAGCTCTAGCTGATAGG + Intergenic
996459442 5:123724872-123724894 AAGCTCAAGCTTCAATTGATGGG - Intergenic
999374154 5:151075211-151075233 AAGGAGAAATTTCAACTGATTGG + Intronic
1000043679 5:157504004-157504026 AAGGAAAAGCTCCAGTTTCTTGG - Intronic
1000386369 5:160678335-160678357 AAGGTTAAGCTTGAGATGATTGG + Intronic
1002865205 6:1115691-1115713 AAGGAGATGCTTGGGGTGATGGG - Intergenic
1004114341 6:12751031-12751053 AAAGAGAACCTTCAGATGATGGG + Intronic
1007083360 6:39124873-39124895 ATGGAGAAGCTTCAGGTAATAGG - Intergenic
1011127908 6:84026700-84026722 ATGAGGAAGCTTCAGTTTATTGG - Intergenic
1017127812 6:151081934-151081956 AAGGAGAAGCTGGAGGAGATGGG - Intronic
1017718909 6:157231362-157231384 AAGGAGAAGATTCAGGAGCTGGG - Intergenic
1018130514 6:160727580-160727602 GAAGAGAAGCTTCACTTGTTTGG - Intronic
1018693679 6:166371947-166371969 AAGGAGAAACTGCAGATGAGGGG + Intronic
1019933577 7:4239801-4239823 AAAGAGAAGACCCAGTTGATGGG - Intronic
1021777182 7:24065412-24065434 CAGGAGAAGCTTCAATAGGTGGG - Intergenic
1022951249 7:35340189-35340211 AATGAGGAGCTTCAGGGGATTGG + Intergenic
1024662305 7:51510363-51510385 AAGGAGAGACTTCATTTGTTTGG - Intergenic
1024832928 7:53482796-53482818 GAGGACAAGCTTCAATTCATAGG - Intergenic
1028823369 7:95239487-95239509 AGGTAGAGGCTTCAGTTGAGTGG + Intronic
1030568257 7:111188023-111188045 AAGGAGAAGCTTTAGTAGGAAGG + Intronic
1032747113 7:134796979-134797001 GAGGAAAAGCTTCAATTGAATGG - Intronic
1032842238 7:135723439-135723461 AGGGAGAGGCTGCAGTTCATGGG + Intronic
1033662960 7:143415598-143415620 AAGGGGAAGCTGAAGTTGAAGGG + Intergenic
1035753938 8:2017270-2017292 AGAGAGAAGCTCCAGTTGTTTGG - Intergenic
1037150558 8:15630176-15630198 AAGAAGAAAATTCAGTTGAAGGG + Intronic
1037836268 8:22216480-22216502 AAGGGGAAGCTTCAGATGCCAGG - Intergenic
1038347630 8:26746972-26746994 AAGGAGTAGCTTAATTCGATTGG + Intergenic
1039131133 8:34265271-34265293 AAGCAGAGGCTCCAGATGATAGG - Intergenic
1040786908 8:51176935-51176957 TAGGAAAAGCATCATTTGATTGG + Intergenic
1041004997 8:53488938-53488960 AAAGAGAAGTTTCAGTGGAGTGG - Intergenic
1041793447 8:61721957-61721979 AAGGAGGATTTTCTGTTGATTGG - Intergenic
1042460579 8:69060834-69060856 AAAGAGAAGCTTGATTTGAATGG - Intergenic
1046802233 8:118441057-118441079 AAGGAGAGCCTTCATTTGGTAGG + Intronic
1047888062 8:129274845-129274867 AAGGAGAATTGGCAGTTGATTGG + Intergenic
1048945400 8:139442420-139442442 AAGAAGAAGCTTCAGAGCATGGG + Intergenic
1049344286 8:142130232-142130254 AAGGAGAAGCTTTGGTTCAGAGG - Intergenic
1050199912 9:3133200-3133222 GAGGAGAAGTCTCAGCTGATTGG + Intergenic
1051209473 9:14726516-14726538 AAGGAGCAGCTTCAGGGAATGGG - Intergenic
1052750264 9:32483020-32483042 TAGGATAAGCCTCAGTTGCTTGG + Intronic
1055759025 9:79586921-79586943 AGGGAAATGCTTGAGTTGATGGG - Intronic
1058650624 9:107172612-107172634 AAGGAGAAATTGCACTTGATGGG - Intergenic
1058822498 9:108745437-108745459 AAGGAGAAGCATGAGTGGATTGG - Intergenic
1060330630 9:122666034-122666056 ATGGAGAAGCTGCAGTTTAGTGG - Intergenic
1060971783 9:127742562-127742584 AAGGAGGAGCCCCAGCTGATGGG + Intronic
1185886584 X:3788909-3788931 AATGAGATCCTTCAGGTGATAGG + Intergenic
1186457434 X:9720963-9720985 AAGGAGGAGCTTCAATGGACTGG - Intergenic
1191680674 X:63836895-63836917 AAGGGGAAGCTTCAGTGACTTGG + Intergenic
1192989594 X:76435234-76435256 GAGAAGCAGCTGCAGTTGATTGG - Intergenic
1193471741 X:81912685-81912707 AAGCAGAGGCTTCACTTGTTAGG - Intergenic
1198046388 X:132907383-132907405 AAGCAGAAGGTTCAGTAGCTAGG - Intronic