ID: 1151057310

View in Genome Browser
Species Human (GRCh38)
Location 17:71048565-71048587
Sequence GCTACCACATAGAACTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151057310_1151057311 -1 Left 1151057310 17:71048565-71048587 CCTGCTTAGTTCTATGTGGTAGC No data
Right 1151057311 17:71048587-71048609 CTCTAGATTTCACCTACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151057310 Original CRISPR GCTACCACATAGAACTAAGC AGG (reversed) Intergenic
No off target data available for this crispr