ID: 1151060246

View in Genome Browser
Species Human (GRCh38)
Location 17:71084126-71084148
Sequence CTAGATACCAAGGTGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151060246_1151060252 30 Left 1151060246 17:71084126-71084148 CCCTTCTCCACCTTGGTATCTAG No data
Right 1151060252 17:71084179-71084201 ACCCATGGCAACATTATTGCAGG No data
1151060246_1151060251 15 Left 1151060246 17:71084126-71084148 CCCTTCTCCACCTTGGTATCTAG No data
Right 1151060251 17:71084164-71084186 GTTCTGTGAGAGTCGACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151060246 Original CRISPR CTAGATACCAAGGTGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr