ID: 1151069819

View in Genome Browser
Species Human (GRCh38)
Location 17:71196059-71196081
Sequence AGAGGGGACCAACAGCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151069819_1151069825 19 Left 1151069819 17:71196059-71196081 CCTGGTGGCTGTTGGTCCCCTCT No data
Right 1151069825 17:71196101-71196123 TTGTTTCATTCCCACTTATAAGG No data
1151069819_1151069826 20 Left 1151069819 17:71196059-71196081 CCTGGTGGCTGTTGGTCCCCTCT No data
Right 1151069826 17:71196102-71196124 TGTTTCATTCCCACTTATAAGGG No data
1151069819_1151069820 -9 Left 1151069819 17:71196059-71196081 CCTGGTGGCTGTTGGTCCCCTCT No data
Right 1151069820 17:71196073-71196095 GTCCCCTCTTTGTGTCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151069819 Original CRISPR AGAGGGGACCAACAGCCACC AGG (reversed) Intergenic
No off target data available for this crispr