ID: 1151071748

View in Genome Browser
Species Human (GRCh38)
Location 17:71221780-71221802
Sequence CCTACTAGGTAGTGAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151071748_1151071752 4 Left 1151071748 17:71221780-71221802 CCTGTTACTCACTACCTAGTAGG No data
Right 1151071752 17:71221807-71221829 TCAACCCTCCTAGTTTGCCTAGG No data
1151071748_1151071758 21 Left 1151071748 17:71221780-71221802 CCTGTTACTCACTACCTAGTAGG No data
Right 1151071758 17:71221824-71221846 CCTAGGATTGAAAGGTTTCCTGG No data
1151071748_1151071759 29 Left 1151071748 17:71221780-71221802 CCTGTTACTCACTACCTAGTAGG No data
Right 1151071759 17:71221832-71221854 TGAAAGGTTTCCTGGACCACAGG No data
1151071748_1151071756 13 Left 1151071748 17:71221780-71221802 CCTGTTACTCACTACCTAGTAGG No data
Right 1151071756 17:71221816-71221838 CTAGTTTGCCTAGGATTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151071748 Original CRISPR CCTACTAGGTAGTGAGTAAC AGG (reversed) Intergenic
No off target data available for this crispr