ID: 1151073864

View in Genome Browser
Species Human (GRCh38)
Location 17:71248725-71248747
Sequence CTGTGTAAGTTGAAATAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151073860_1151073864 1 Left 1151073860 17:71248701-71248723 CCATTCTTTAGTACCAATAAAAG No data
Right 1151073864 17:71248725-71248747 CTGTGTAAGTTGAAATAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151073864 Original CRISPR CTGTGTAAGTTGAAATAGAA GGG Intergenic
No off target data available for this crispr