ID: 1151076175

View in Genome Browser
Species Human (GRCh38)
Location 17:71275352-71275374
Sequence CCAACACTAAATGGTTCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151076168_1151076175 12 Left 1151076168 17:71275317-71275339 CCTTCCTTGCAGTCTATAGTTCA No data
Right 1151076175 17:71275352-71275374 CCAACACTAAATGGTTCTAAAGG No data
1151076170_1151076175 8 Left 1151076170 17:71275321-71275343 CCTTGCAGTCTATAGTTCAGGAA No data
Right 1151076175 17:71275352-71275374 CCAACACTAAATGGTTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151076175 Original CRISPR CCAACACTAAATGGTTCTAA AGG Intergenic
No off target data available for this crispr