ID: 1151084510

View in Genome Browser
Species Human (GRCh38)
Location 17:71365106-71365128
Sequence CCTGCCCTTAGCCCCCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151084506_1151084510 21 Left 1151084506 17:71365062-71365084 CCTAAATTGGTAAGTTAATGGAG No data
Right 1151084510 17:71365106-71365128 CCTGCCCTTAGCCCCCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151084510 Original CRISPR CCTGCCCTTAGCCCCCCTGA TGG Intergenic
No off target data available for this crispr