ID: 1151085481

View in Genome Browser
Species Human (GRCh38)
Location 17:71375677-71375699
Sequence CAGGATATACGTAGATATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151085478_1151085481 -5 Left 1151085478 17:71375659-71375681 CCAGAAAGACAGAACCCACAGGA No data
Right 1151085481 17:71375677-71375699 CAGGATATACGTAGATATACAGG No data
1151085476_1151085481 11 Left 1151085476 17:71375643-71375665 CCTGGATTGGGGTTCTCCAGAAA No data
Right 1151085481 17:71375677-71375699 CAGGATATACGTAGATATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151085481 Original CRISPR CAGGATATACGTAGATATAC AGG Intergenic
No off target data available for this crispr