ID: 1151090926

View in Genome Browser
Species Human (GRCh38)
Location 17:71439529-71439551
Sequence GTAGAACTCCAGCTCAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151090919_1151090926 16 Left 1151090919 17:71439490-71439512 CCCTTTGTCTTCCCAGTTTTCAT No data
Right 1151090926 17:71439529-71439551 GTAGAACTCCAGCTCAGGAATGG No data
1151090921_1151090926 5 Left 1151090921 17:71439501-71439523 CCCAGTTTTCATCTCCAGACCAT No data
Right 1151090926 17:71439529-71439551 GTAGAACTCCAGCTCAGGAATGG No data
1151090918_1151090926 28 Left 1151090918 17:71439478-71439500 CCTCTTCAGGCTCCCTTTGTCTT No data
Right 1151090926 17:71439529-71439551 GTAGAACTCCAGCTCAGGAATGG No data
1151090916_1151090926 30 Left 1151090916 17:71439476-71439498 CCCCTCTTCAGGCTCCCTTTGTC No data
Right 1151090926 17:71439529-71439551 GTAGAACTCCAGCTCAGGAATGG No data
1151090917_1151090926 29 Left 1151090917 17:71439477-71439499 CCCTCTTCAGGCTCCCTTTGTCT No data
Right 1151090926 17:71439529-71439551 GTAGAACTCCAGCTCAGGAATGG No data
1151090920_1151090926 15 Left 1151090920 17:71439491-71439513 CCTTTGTCTTCCCAGTTTTCATC No data
Right 1151090926 17:71439529-71439551 GTAGAACTCCAGCTCAGGAATGG No data
1151090922_1151090926 4 Left 1151090922 17:71439502-71439524 CCAGTTTTCATCTCCAGACCATG No data
Right 1151090926 17:71439529-71439551 GTAGAACTCCAGCTCAGGAATGG No data
1151090923_1151090926 -9 Left 1151090923 17:71439515-71439537 CCAGACCATGATTCGTAGAACTC No data
Right 1151090926 17:71439529-71439551 GTAGAACTCCAGCTCAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151090926 Original CRISPR GTAGAACTCCAGCTCAGGAA TGG Intergenic
No off target data available for this crispr