ID: 1151094674

View in Genome Browser
Species Human (GRCh38)
Location 17:71482858-71482880
Sequence CAATAAATGTTCAGTAATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151094671_1151094674 10 Left 1151094671 17:71482825-71482847 CCCAGCACGATGTTCTGCATAGA No data
Right 1151094674 17:71482858-71482880 CAATAAATGTTCAGTAATTATGG No data
1151094669_1151094674 17 Left 1151094669 17:71482818-71482840 CCCAATGCCCAGCACGATGTTCT No data
Right 1151094674 17:71482858-71482880 CAATAAATGTTCAGTAATTATGG No data
1151094672_1151094674 9 Left 1151094672 17:71482826-71482848 CCAGCACGATGTTCTGCATAGAA No data
Right 1151094674 17:71482858-71482880 CAATAAATGTTCAGTAATTATGG No data
1151094670_1151094674 16 Left 1151094670 17:71482819-71482841 CCAATGCCCAGCACGATGTTCTG No data
Right 1151094674 17:71482858-71482880 CAATAAATGTTCAGTAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151094674 Original CRISPR CAATAAATGTTCAGTAATTA TGG Intergenic
No off target data available for this crispr