ID: 1151096926

View in Genome Browser
Species Human (GRCh38)
Location 17:71509195-71509217
Sequence CCGGCACCTGCACTTCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151096920_1151096926 17 Left 1151096920 17:71509155-71509177 CCATCAACATCTCACCTTCCTTA No data
Right 1151096926 17:71509195-71509217 CCGGCACCTGCACTTCTTTGAGG No data
1151096922_1151096926 -1 Left 1151096922 17:71509173-71509195 CCTTACCACTTCAGTGCAGCTGC No data
Right 1151096926 17:71509195-71509217 CCGGCACCTGCACTTCTTTGAGG No data
1151096924_1151096926 -6 Left 1151096924 17:71509178-71509200 CCACTTCAGTGCAGCTGCCGGCA No data
Right 1151096926 17:71509195-71509217 CCGGCACCTGCACTTCTTTGAGG No data
1151096921_1151096926 3 Left 1151096921 17:71509169-71509191 CCTTCCTTACCACTTCAGTGCAG No data
Right 1151096926 17:71509195-71509217 CCGGCACCTGCACTTCTTTGAGG No data
1151096919_1151096926 18 Left 1151096919 17:71509154-71509176 CCCATCAACATCTCACCTTCCTT No data
Right 1151096926 17:71509195-71509217 CCGGCACCTGCACTTCTTTGAGG No data
1151096918_1151096926 19 Left 1151096918 17:71509153-71509175 CCCCATCAACATCTCACCTTCCT No data
Right 1151096926 17:71509195-71509217 CCGGCACCTGCACTTCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151096926 Original CRISPR CCGGCACCTGCACTTCTTTG AGG Intergenic
No off target data available for this crispr