ID: 1151098480

View in Genome Browser
Species Human (GRCh38)
Location 17:71527489-71527511
Sequence CTGCGGTTTGGCTGGTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151098480_1151098487 13 Left 1151098480 17:71527489-71527511 CCATGTAACCAGCCAAACCGCAG No data
Right 1151098487 17:71527525-71527547 ACCAGGGAGTTGACTTCTCAAGG No data
1151098480_1151098489 17 Left 1151098480 17:71527489-71527511 CCATGTAACCAGCCAAACCGCAG No data
Right 1151098489 17:71527529-71527551 GGGAGTTGACTTCTCAAGGAAGG No data
1151098480_1151098485 -4 Left 1151098480 17:71527489-71527511 CCATGTAACCAGCCAAACCGCAG No data
Right 1151098485 17:71527508-71527530 GCAGGAGCTAATCTCAAACCAGG No data
1151098480_1151098490 27 Left 1151098480 17:71527489-71527511 CCATGTAACCAGCCAAACCGCAG No data
Right 1151098490 17:71527539-71527561 TTCTCAAGGAAGGAGTCCTGTGG No data
1151098480_1151098486 -3 Left 1151098480 17:71527489-71527511 CCATGTAACCAGCCAAACCGCAG No data
Right 1151098486 17:71527509-71527531 CAGGAGCTAATCTCAAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151098480 Original CRISPR CTGCGGTTTGGCTGGTTACA TGG (reversed) Intergenic
No off target data available for this crispr