ID: 1151098482

View in Genome Browser
Species Human (GRCh38)
Location 17:71527497-71527519
Sequence ATTAGCTCCTGCGGTTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151098482_1151098490 19 Left 1151098482 17:71527497-71527519 CCAGCCAAACCGCAGGAGCTAAT No data
Right 1151098490 17:71527539-71527561 TTCTCAAGGAAGGAGTCCTGTGG No data
1151098482_1151098489 9 Left 1151098482 17:71527497-71527519 CCAGCCAAACCGCAGGAGCTAAT No data
Right 1151098489 17:71527529-71527551 GGGAGTTGACTTCTCAAGGAAGG No data
1151098482_1151098487 5 Left 1151098482 17:71527497-71527519 CCAGCCAAACCGCAGGAGCTAAT No data
Right 1151098487 17:71527525-71527547 ACCAGGGAGTTGACTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151098482 Original CRISPR ATTAGCTCCTGCGGTTTGGC TGG (reversed) Intergenic
No off target data available for this crispr