ID: 1151098484

View in Genome Browser
Species Human (GRCh38)
Location 17:71527506-71527528
Sequence TGGTTTGAGATTAGCTCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151098484_1151098490 10 Left 1151098484 17:71527506-71527528 CCGCAGGAGCTAATCTCAAACCA No data
Right 1151098490 17:71527539-71527561 TTCTCAAGGAAGGAGTCCTGTGG No data
1151098484_1151098487 -4 Left 1151098484 17:71527506-71527528 CCGCAGGAGCTAATCTCAAACCA No data
Right 1151098487 17:71527525-71527547 ACCAGGGAGTTGACTTCTCAAGG No data
1151098484_1151098489 0 Left 1151098484 17:71527506-71527528 CCGCAGGAGCTAATCTCAAACCA No data
Right 1151098489 17:71527529-71527551 GGGAGTTGACTTCTCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151098484 Original CRISPR TGGTTTGAGATTAGCTCCTG CGG (reversed) Intergenic
No off target data available for this crispr