ID: 1151098485

View in Genome Browser
Species Human (GRCh38)
Location 17:71527508-71527530
Sequence GCAGGAGCTAATCTCAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151098480_1151098485 -4 Left 1151098480 17:71527489-71527511 CCATGTAACCAGCCAAACCGCAG No data
Right 1151098485 17:71527508-71527530 GCAGGAGCTAATCTCAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151098485 Original CRISPR GCAGGAGCTAATCTCAAACC AGG Intergenic
No off target data available for this crispr