ID: 1151098487

View in Genome Browser
Species Human (GRCh38)
Location 17:71527525-71527547
Sequence ACCAGGGAGTTGACTTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151098483_1151098487 1 Left 1151098483 17:71527501-71527523 CCAAACCGCAGGAGCTAATCTCA No data
Right 1151098487 17:71527525-71527547 ACCAGGGAGTTGACTTCTCAAGG No data
1151098480_1151098487 13 Left 1151098480 17:71527489-71527511 CCATGTAACCAGCCAAACCGCAG No data
Right 1151098487 17:71527525-71527547 ACCAGGGAGTTGACTTCTCAAGG No data
1151098482_1151098487 5 Left 1151098482 17:71527497-71527519 CCAGCCAAACCGCAGGAGCTAAT No data
Right 1151098487 17:71527525-71527547 ACCAGGGAGTTGACTTCTCAAGG No data
1151098484_1151098487 -4 Left 1151098484 17:71527506-71527528 CCGCAGGAGCTAATCTCAAACCA No data
Right 1151098487 17:71527525-71527547 ACCAGGGAGTTGACTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151098487 Original CRISPR ACCAGGGAGTTGACTTCTCA AGG Intergenic
No off target data available for this crispr