ID: 1151098488

View in Genome Browser
Species Human (GRCh38)
Location 17:71527526-71527548
Sequence TCCTTGAGAAGTCAACTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151098488_1151098490 -10 Left 1151098488 17:71527526-71527548 CCAGGGAGTTGACTTCTCAAGGA No data
Right 1151098490 17:71527539-71527561 TTCTCAAGGAAGGAGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151098488 Original CRISPR TCCTTGAGAAGTCAACTCCC TGG (reversed) Intergenic
No off target data available for this crispr