ID: 1151099487

View in Genome Browser
Species Human (GRCh38)
Location 17:71540400-71540422
Sequence GCACTTTGGGAGGCCGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 784994
Summary {0: 36192, 1: 181118, 2: 265840, 3: 185597, 4: 116247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151099487_1151099497 20 Left 1151099487 17:71540400-71540422 CCCACCTCGGCCTCCCAAAGTGC 0: 36192
1: 181118
2: 265840
3: 185597
4: 116247
Right 1151099497 17:71540443-71540465 ACTGCACCTGGCTGAATGAAGGG No data
1151099487_1151099494 8 Left 1151099487 17:71540400-71540422 CCCACCTCGGCCTCCCAAAGTGC 0: 36192
1: 181118
2: 265840
3: 185597
4: 116247
Right 1151099494 17:71540431-71540453 CAGATGTGAGCCACTGCACCTGG 0: 414
1: 6737
2: 26205
3: 68577
4: 122154
1151099487_1151099500 30 Left 1151099487 17:71540400-71540422 CCCACCTCGGCCTCCCAAAGTGC 0: 36192
1: 181118
2: 265840
3: 185597
4: 116247
Right 1151099500 17:71540453-71540475 GCTGAATGAAGGGGTTTTAGAGG No data
1151099487_1151099498 21 Left 1151099487 17:71540400-71540422 CCCACCTCGGCCTCCCAAAGTGC 0: 36192
1: 181118
2: 265840
3: 185597
4: 116247
Right 1151099498 17:71540444-71540466 CTGCACCTGGCTGAATGAAGGGG No data
1151099487_1151099496 19 Left 1151099487 17:71540400-71540422 CCCACCTCGGCCTCCCAAAGTGC 0: 36192
1: 181118
2: 265840
3: 185597
4: 116247
Right 1151099496 17:71540442-71540464 CACTGCACCTGGCTGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151099487 Original CRISPR GCACTTTGGGAGGCCGAGGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr