ID: 1151099488

View in Genome Browser
Species Human (GRCh38)
Location 17:71540401-71540423
Sequence AGCACTTTGGGAGGCCGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 536358
Summary {0: 87986, 1: 182858, 2: 138884, 3: 74939, 4: 51691}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151099488_1151099500 29 Left 1151099488 17:71540401-71540423 CCACCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 1151099500 17:71540453-71540475 GCTGAATGAAGGGGTTTTAGAGG No data
1151099488_1151099494 7 Left 1151099488 17:71540401-71540423 CCACCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 1151099494 17:71540431-71540453 CAGATGTGAGCCACTGCACCTGG 0: 414
1: 6737
2: 26205
3: 68577
4: 122154
1151099488_1151099496 18 Left 1151099488 17:71540401-71540423 CCACCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 1151099496 17:71540442-71540464 CACTGCACCTGGCTGAATGAAGG No data
1151099488_1151099497 19 Left 1151099488 17:71540401-71540423 CCACCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 1151099497 17:71540443-71540465 ACTGCACCTGGCTGAATGAAGGG No data
1151099488_1151099498 20 Left 1151099488 17:71540401-71540423 CCACCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 1151099498 17:71540444-71540466 CTGCACCTGGCTGAATGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151099488 Original CRISPR AGCACTTTGGGAGGCCGAGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr