ID: 1151099489

View in Genome Browser
Species Human (GRCh38)
Location 17:71540404-71540426
Sequence CTCAGCACTTTGGGAGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 745856
Summary {0: 5533, 1: 132266, 2: 273114, 3: 208814, 4: 126129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151099489_1151099500 26 Left 1151099489 17:71540404-71540426 CCTCGGCCTCCCAAAGTGCTGAG 0: 5533
1: 132266
2: 273114
3: 208814
4: 126129
Right 1151099500 17:71540453-71540475 GCTGAATGAAGGGGTTTTAGAGG No data
1151099489_1151099496 15 Left 1151099489 17:71540404-71540426 CCTCGGCCTCCCAAAGTGCTGAG 0: 5533
1: 132266
2: 273114
3: 208814
4: 126129
Right 1151099496 17:71540442-71540464 CACTGCACCTGGCTGAATGAAGG No data
1151099489_1151099494 4 Left 1151099489 17:71540404-71540426 CCTCGGCCTCCCAAAGTGCTGAG 0: 5533
1: 132266
2: 273114
3: 208814
4: 126129
Right 1151099494 17:71540431-71540453 CAGATGTGAGCCACTGCACCTGG 0: 414
1: 6737
2: 26205
3: 68577
4: 122154
1151099489_1151099498 17 Left 1151099489 17:71540404-71540426 CCTCGGCCTCCCAAAGTGCTGAG 0: 5533
1: 132266
2: 273114
3: 208814
4: 126129
Right 1151099498 17:71540444-71540466 CTGCACCTGGCTGAATGAAGGGG No data
1151099489_1151099497 16 Left 1151099489 17:71540404-71540426 CCTCGGCCTCCCAAAGTGCTGAG 0: 5533
1: 132266
2: 273114
3: 208814
4: 126129
Right 1151099497 17:71540443-71540465 ACTGCACCTGGCTGAATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151099489 Original CRISPR CTCAGCACTTTGGGAGGCCG AGG (reversed) Intergenic
Too many off-targets to display for this crispr