ID: 1151099491

View in Genome Browser
Species Human (GRCh38)
Location 17:71540410-71540432
Sequence TGTAACCTCAGCACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 743926
Summary {0: 295, 1: 21764, 2: 316339, 3: 261082, 4: 144446}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151099491_1151099498 11 Left 1151099491 17:71540410-71540432 CCTCCCAAAGTGCTGAGGTTACA 0: 295
1: 21764
2: 316339
3: 261082
4: 144446
Right 1151099498 17:71540444-71540466 CTGCACCTGGCTGAATGAAGGGG No data
1151099491_1151099497 10 Left 1151099491 17:71540410-71540432 CCTCCCAAAGTGCTGAGGTTACA 0: 295
1: 21764
2: 316339
3: 261082
4: 144446
Right 1151099497 17:71540443-71540465 ACTGCACCTGGCTGAATGAAGGG No data
1151099491_1151099494 -2 Left 1151099491 17:71540410-71540432 CCTCCCAAAGTGCTGAGGTTACA 0: 295
1: 21764
2: 316339
3: 261082
4: 144446
Right 1151099494 17:71540431-71540453 CAGATGTGAGCCACTGCACCTGG 0: 414
1: 6737
2: 26205
3: 68577
4: 122154
1151099491_1151099500 20 Left 1151099491 17:71540410-71540432 CCTCCCAAAGTGCTGAGGTTACA 0: 295
1: 21764
2: 316339
3: 261082
4: 144446
Right 1151099500 17:71540453-71540475 GCTGAATGAAGGGGTTTTAGAGG No data
1151099491_1151099496 9 Left 1151099491 17:71540410-71540432 CCTCCCAAAGTGCTGAGGTTACA 0: 295
1: 21764
2: 316339
3: 261082
4: 144446
Right 1151099496 17:71540442-71540464 CACTGCACCTGGCTGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151099491 Original CRISPR TGTAACCTCAGCACTTTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr