ID: 1151099493

View in Genome Browser
Species Human (GRCh38)
Location 17:71540414-71540436
Sequence CATCTGTAACCTCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151099493_1151099494 -6 Left 1151099493 17:71540414-71540436 CCAAAGTGCTGAGGTTACAGATG No data
Right 1151099494 17:71540431-71540453 CAGATGTGAGCCACTGCACCTGG 0: 414
1: 6737
2: 26205
3: 68577
4: 122154
1151099493_1151099497 6 Left 1151099493 17:71540414-71540436 CCAAAGTGCTGAGGTTACAGATG No data
Right 1151099497 17:71540443-71540465 ACTGCACCTGGCTGAATGAAGGG No data
1151099493_1151099496 5 Left 1151099493 17:71540414-71540436 CCAAAGTGCTGAGGTTACAGATG No data
Right 1151099496 17:71540442-71540464 CACTGCACCTGGCTGAATGAAGG No data
1151099493_1151099498 7 Left 1151099493 17:71540414-71540436 CCAAAGTGCTGAGGTTACAGATG No data
Right 1151099498 17:71540444-71540466 CTGCACCTGGCTGAATGAAGGGG No data
1151099493_1151099500 16 Left 1151099493 17:71540414-71540436 CCAAAGTGCTGAGGTTACAGATG No data
Right 1151099500 17:71540453-71540475 GCTGAATGAAGGGGTTTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151099493 Original CRISPR CATCTGTAACCTCAGCACTT TGG (reversed) Intergenic
No off target data available for this crispr