ID: 1151099494

View in Genome Browser
Species Human (GRCh38)
Location 17:71540431-71540453
Sequence CAGATGTGAGCCACTGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224087
Summary {0: 414, 1: 6737, 2: 26205, 3: 68577, 4: 122154}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151099489_1151099494 4 Left 1151099489 17:71540404-71540426 CCTCGGCCTCCCAAAGTGCTGAG 0: 5533
1: 132266
2: 273114
3: 208814
4: 126129
Right 1151099494 17:71540431-71540453 CAGATGTGAGCCACTGCACCTGG 0: 414
1: 6737
2: 26205
3: 68577
4: 122154
1151099492_1151099494 -5 Left 1151099492 17:71540413-71540435 CCCAAAGTGCTGAGGTTACAGAT No data
Right 1151099494 17:71540431-71540453 CAGATGTGAGCCACTGCACCTGG 0: 414
1: 6737
2: 26205
3: 68577
4: 122154
1151099488_1151099494 7 Left 1151099488 17:71540401-71540423 CCACCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 1151099494 17:71540431-71540453 CAGATGTGAGCCACTGCACCTGG 0: 414
1: 6737
2: 26205
3: 68577
4: 122154
1151099485_1151099494 22 Left 1151099485 17:71540386-71540408 CCTTAAGCAATCTGCCCACCTCG 0: 2
1: 59
2: 627
3: 4751
4: 21188
Right 1151099494 17:71540431-71540453 CAGATGTGAGCCACTGCACCTGG 0: 414
1: 6737
2: 26205
3: 68577
4: 122154
1151099491_1151099494 -2 Left 1151099491 17:71540410-71540432 CCTCCCAAAGTGCTGAGGTTACA 0: 295
1: 21764
2: 316339
3: 261082
4: 144446
Right 1151099494 17:71540431-71540453 CAGATGTGAGCCACTGCACCTGG 0: 414
1: 6737
2: 26205
3: 68577
4: 122154
1151099493_1151099494 -6 Left 1151099493 17:71540414-71540436 CCAAAGTGCTGAGGTTACAGATG No data
Right 1151099494 17:71540431-71540453 CAGATGTGAGCCACTGCACCTGG 0: 414
1: 6737
2: 26205
3: 68577
4: 122154
1151099487_1151099494 8 Left 1151099487 17:71540400-71540422 CCCACCTCGGCCTCCCAAAGTGC 0: 36192
1: 181118
2: 265840
3: 185597
4: 116247
Right 1151099494 17:71540431-71540453 CAGATGTGAGCCACTGCACCTGG 0: 414
1: 6737
2: 26205
3: 68577
4: 122154
1151099484_1151099494 27 Left 1151099484 17:71540381-71540403 CCTGACCTTAAGCAATCTGCCCA No data
Right 1151099494 17:71540431-71540453 CAGATGTGAGCCACTGCACCTGG 0: 414
1: 6737
2: 26205
3: 68577
4: 122154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151099494 Original CRISPR CAGATGTGAGCCACTGCACC TGG Intergenic
Too many off-targets to display for this crispr